We narrowed to 6,088 results for: cat.2
-
Plasmid#163326PurposeRetroviral vector for knockdown of murine CD247A (TCR zeta) and expression of a CD90.2 surface marker under control of the CAG promoter.DepositorInsertCD90.2 (Thy1 Mouse)
UseRNAi and RetroviralTagsExpressionMammalianMutationPromoterCAGAvailable sinceJan. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMX-mPGK-CD90.2-Cd247A_miR
Plasmid#163327PurposeRetroviral vector for knockdown of murine CD247A (TCR zeta) and expression of a CD90.2 surface marker under control of the murine PGK promoter.DepositorInsertCD90.2 (Thy1 Mouse)
UseRNAi and RetroviralTagsExpressionMammalianMutationPromotermPGKAvailable sinceJan. 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMX-hFTH1-CD90.2-Cd247A_miR
Plasmid#163325PurposeRetroviral vector for knockdown of murine CD247A (TCR zeta) and expression of a CD90.2 surface marker under control of the human FTH1 promoter.DepositorInsertCD90.2 (Thy1 Mouse)
UseRNAi and RetroviralTagsExpressionMammalianMutationPromoterhFTH1Available sinceJan. 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMX-hPGK-CD90.2-Cd247A_miR
Plasmid#163324PurposeRetroviral vector for knockdown of murine CD247A (TCR zeta) and expression of a CD90.2 surface marker under control of the human PGK promoter.DepositorInsertCD90.2 (Thy1 Mouse)
UseRNAi and RetroviralTagsExpressionMammalianMutationPromoterhPGKAvailable sinceJan. 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
Ad:2CMV_A2R2-N25Ctr
Plasmid#122243PurposeExpresses a dominant negative Kash control, that lacks the actual Kash domain for LINC complex integration, in addition to fluorescently tagged (mRuby2) α-Actinin-2 on an adenoviral backboneDepositorUseAdenoviralTagsSignal Peptide (TOR1A, NM_000113.2), mNeptune2.5,…ExpressionMammalianMutationdeleted Kash domain (GGCGAGGAGGAGCGCAGCTGCGCCCTGG…PromoterCMVAvailable sinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
TFORF0257
Plasmid#141560PurposeLentiviral vector for overexpressing the TCF4 transcription factor ORF with a unique 24-bp barcode. Barcodes facilitate identification of transcription factors in pooled screens.DepositorInsertTCF4 (TCF4 Human)
UseLentiviralTagsExpressionMammalianMutationPromoterEF1aAvailable sinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
TFORF3520
Plasmid#144996PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorInsertTCF4 (TCF4 Human)
UseLentiviralTagsV5ExpressionMammalianMutationPromoterEF1aAvailable sinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
TFORF3519
Plasmid#144995PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorInsertTCF4 (TCF4 Human)
UseLentiviralTagsExpressionMammalianMutationPromoterEF1aAvailable sinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGEX-6p-1_GST-DmKHC[1-421]_1xmNeonGreen
Plasmid#196974PurposeBacterial expression plasmid for GST-based purification of Drosophila melanogaster kinesin heavy chain [1-421] with C-terminal mNeonGreen tag and cleavable N-terminal GST tagDepositorInsertKinesin Heavy Chain (Khc Fly)
UseTagsGST and mNeonGreenExpressionBacterialMutationPromotertacAvailable sinceJuly 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pET28a_DmKHC[1-421]-SNAP-6xHis
Plasmid#196975PurposeBacterial expression plasmid for His tag-based purification of Drosophila melanogaster kinesin heavy chain [1-421] with C-terminal SNAP tag and C-terminal 6xHis tagDepositorInsertKinesin Heavy Chain (Khc Fly)
UseTags6xHis and SNAPExpressionBacterialMutationPromoterT7 promoterAvailable sinceJuly 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
p2xp53_RE
Plasmid#118053PurposeGBPart - Operator/DNA Response element - 2 copies of the p53 DNA binding motifDepositorInsert2 copies of the p53 DNA binding motif
UseSynthetic Biology; Domestication of dna parts for…TagsExpressionMutationPromoterAvailable sinceDec. 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
-
9336-E24
Plasmid#234307PurposeGateway ORF Entry clone of human SMAD3 truncated with stop codon (for native or N-terminal fusions); C-term truncation to delete phosphorylation sitesDepositorInsertSMAD3 truncated (SMAD3 Human)
UseGateway entry cloneTagsExpressionMutationdel(422-425); C-term truncation to delete phospho…PromoterAvailable sinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAB2076 pAAV REPAIR.t1
Plasmid#176323PurposepAAV EFS-HIVNES-dCas13bt1- (GGS)2-huADAR2(E488Q)-3xHA BGHpolyA::U6-BpiI-Cas13bt1 DR (full REPAIR.t1 + crRNA expression for AAV production)DepositorInsertshuman codon optimized Cas13bt1 (catalytically inactivated)
huADAR2dd(E488Q) (ADARB1 Human)
Cas13bt1 crRNA + BpiI cloning site
UseAAV and CRISPRTags3xHA and HIV NESExpressionMammalianMutationE488Q, only the deaminase domain (aa 276-702 are …PromoterEFS (short EF1alpha) and hU6Available sinceOct. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRSET-RCaMP1h
Plasmid#42874Purposea single-wavelength red-shifted genetically encoded calcium indicator constructed from calmodulin and cp-mRubyDepositorInsertRed Fluorescent Calcium binding Protein
UseTagsEK (Enterokinase) Recognition Site, His Tag (6x),…ExpressionBacterialMutationPromoterT7Available sinceFeb. 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
pDONOR-MARINA
Plasmid#223328PurposeDONOR vector for genomic integration of MARINA voltage sensitive indicator gene from Platisa et al., 2017 (10.1021/acschemneuro.6b00234).DepositorInsertsMARINA
KIR2.1 channel Golgi-to-plasma membrane trafficking signal
UseCRISPR and Synthetic BiologyTagsmCherry and super-ecliptic pHluorinExpressionMammalianMutationPromoterCAGAvailable sinceDec. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
MTK2_016
Plasmid#123708PurposeEncodes truncated pCMV as a Type 2 part to be used in the MTK systemDepositorInsertpCMV-A
UseTagsExpressionMammalianMutationPromoterAvailable sinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
MTK2_017
Plasmid#123709PurposeEncodes truncated pCMV as a Type 2 part to be used in the MTK systemDepositorInsertpCMV-B
UseTagsExpressionMammalianMutationPromoterAvailable sinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
MTK2_018
Plasmid#123710PurposeEncodes truncated pCMV as a Type 2 part to be used in the MTK systemDepositorInsertpCMV-C
UseTagsExpressionMammalianMutationPromoterAvailable sinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
MTK2_019
Plasmid#123711PurposeEncodes truncated pCMV as a Type 2 part to be used in the MTK systemDepositorInsertpCMV-D
UseTagsExpressionMammalianMutationPromoterAvailable sinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only