We narrowed to 5,224 results for: Mos;
-
Plasmid#222680Purposeoverexpressing full length TSC22D2 with N-terminal FLAGDepositorAvailable SinceOct. 18, 2024AvailabilityAcademic Institutions and Nonprofits only
-
pLJM1-TSC22D2-FL-C-FLAG
Plasmid#222681Purposeoverexpressing full length TSC22D2 with C-terminal FLAGDepositorAvailable SinceOct. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLJM1-TSC22D2-Nterm-N-FLAG
Plasmid#222682Purposeoverexpressing N-terminus truncation of TSC22D2 with N-terminal FLAGDepositorInsertTSC22D2 (TSC22D2 Human)
UseLentiviralTagsFLAGExpressionMammalianMutationTSC22D2 N-terminus truncationAvailable SinceOct. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLJM1-TSC22D2-Cterm-N-FLAG
Plasmid#222684Purposeoverexpressing C-terminus truncation of TSC22D2 with N-terminal FLAGDepositorInsertTSC22D2 (TSC22D2 Human)
UseLentiviralTagsFLAGExpressionMammalianMutationTSC22D2 C-terminus truncationAvailable SinceOct. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
macroH2A2-V192F-GFP (pc5116)
Plasmid#223439PurposeMutation of valine 192 to phenylalanine (V192F) in macroH2A2.DepositorTagsGFPExpressionMammalianMutationMutation of valine 192 to phenylalanine (V192F)PromoterCMVAvailable SinceOct. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pME-Actin-Vhh-sfGFP-P2A-1xHA-iRFP-caax (JDW 1216)
Plasmid#224496PurposeGateway compatible middle entry clone containing an Actin nanobody fused to sfGFP followed by P2A and iRFP-caax tag (GFP actin reporter and cell membrane iRFP reporter)DepositorInsertActin-Vhh-sfGFP-P2A-HA-iRFP-caax
UseGateway cloningAvailable SinceSept. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
Click editor utilizing mSA for template recruitment and ePhi29 DNA polymerase - pCMV-T7-mSA-nCas9-ePhi29 (JO1398)
Plasmid#217803PurposeVariant CE1 construct with mSA for template recruitment and ePhi29(D169A) DNA pol, expressed from CMV or T7 promoters.DepositorInsertmSA-linker-SV40NLS-nSpCas9-BPNLS-ePhi29-BPNLS
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLSExpressionMammalianMutationnSpCas9(H840A); Phi29(D169A/M8R/V51A/M97T/G197D/E…PromoterCMV and T7Available SinceSept. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
Unfused click editor construct; mSA-ePhi29 - pCMV-T7-mSA-Phi29 (JO1411)
Plasmid#217807PurposeUnfused click editor construct expressing mSA-ePhi29(D169A), expressed from CMV or T7 promoters.DepositorInsertmSA-linker-SV40NLS-ePhi29-BPNLS
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLSExpressionMammalianMutationPhi29(D169A/M8R/V51A/M97T/G197D/E221K/Q497P/K512E…PromoterCMV and T7Available SinceSept. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
Click editor utilizing Cdc13 for template recruitment - pCMV-T7-Cdc13-nCas9-EcKlenow (JO1293)
Plasmid#217796PurposeVariant CE1 construct with Cdc13 telomere binding protein for template recruitment, expressed from CMV or T7 promoters.DepositorInsertCdc13-XTEN-nSpCas9-BPNLS-EcKlenow(-exo)-BPNLS
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLSExpressionMammalianMutationnSpCas9(H840A); EcKlenow(-exo;D355A/E357A)PromoterCMV and T7Available SinceSept. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
Click editor utilizing Cdc13(Y556A) for template recruitment - pCMV-T7-Cdc13(Y556A)-nCas9-EcKlenow (JO1329)
Plasmid#217797PurposeVariant CE1 construct with Cdc13(Y556A) telomere binding protein for template recruitment, expressed from CMV or T7 promoters.DepositorInsertCdc13(Y556A)-XTEN-nSpCas9-BPNLS-EcKlenow(-exo)-BPNLS
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLSExpressionMammalianMutationCdc13(Y556A); nSpCas9(H840A); EcKlenow(-exo;D355A…PromoterCMV and T7Available SinceSept. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-4gRNA-GBX2-RFP
Plasmid#192288PurposeExpresses RFP and four sgRNAs against GBX2DepositorAvailable SinceDec. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV2ss-EFS-GFP-synPolyA-U6-sgHTT1-U6-sgCas9
Plasmid#190903PurposeAAV-KamiCas9 vector expressing expressing thew GFP reporter gene and sgHTT and sgCas9DepositorAvailable SinceMarch 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGEX2T-TEV CHMP1B 186-199 L188A/L192A
Plasmid#108288PurposeExpresses residues 186-199 with L to A mutations at residues 188 and 192 of CHMP1B with an N-terminal GST tag and a TEV cleavage site; Internal ID: WISP 09-286DepositorInsertCHMP1B (CHMP1B Human)
TagsGSTExpressionBacterialMutationchanged L 188 to A, changed L 192 to AAvailable SinceApril 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGEX2T-TEV CHMP1B 186-199 L192A/L195A
Plasmid#108290PurposeExpresses residues 186-199 with L to A mutations at residues 192 and 195 of CHMP1B with an N-terminal GST tag and a TEV cleavage site; Internal ID: WISP 09-287DepositorInsertCHMP1B (CHMP1B Human)
TagsGSTExpressionBacterialMutationchanged L 188 to A, changed L 192 to AAvailable SinceApril 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
CPH3569 (YCp LEU2 Rpb1 P1455_E1456InsGGGGGLEVLFQGP(H)10,K1487N,D1497K; msLink2)
Plasmid#91820PurposeYeast expression of S. cerevisiae Rpb1 with an internal PreScission protease site and 10xHis tag for purification of the linker-CTDDepositorInsertRPO21 (RPO21 Budding Yeast)
Tags10xHisExpressionYeastMutation5xGly linker, PreScission Protease site (LEVLFQGP…PromoterEndogenous Rpb1 promoterAvailable SinceMarch 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
Fibronectin-human-mutated N-terminal (N) O-Glycosylation site
Plasmid#120404Purposeenables eukaryotic expression of human plasma fibronectin in which the first O-glycosylation site was mutated from threonine to serineDepositorInsertFibronectin (FN1 Human)
ExpressionMammalianMutationContaining complete variable region with a mutati…PromoterCMVAvailable SinceJan. 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
Fibronectin-human-mutated V2 O-Glycosylation site
Plasmid#120405Purposeenables eukaryotic expression of human plasma fibronectin in which the second O-glycosylation site was mutated from threonine to serineDepositorInsertFibronectin (FN1 Human)
ExpressionMammalianMutationContains complete variable region with a mutation…PromoterCMVAvailable SinceJan. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
Desmoplakin II donor only control (FL-based no force control)
Plasmid#118722PurposeThe donor (YPet(short)) only control for the no force control of the FL-based human desmoplakin II tension sensor provides the donor only lifetime used in lifetime measurements to determine FRET.DepositorInserthuman Desmoplakin II (1-1353)-[YPet(short)-FL-mCherry(Y72L)] (DSP Human)
UseRetroviralTagsYPet(short)-FL-mCherry(Y72L)ExpressionMammalianMutationtruncation after aa1353; Y72L mutation in mCherry…PromoterCMVAvailable SinceDec. 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
Desmoplakin II acceptor only control (F40-based no force control)
Plasmid#118720PurposeThe acceptor (mCherry) only control for the no force control of the F40-based human desmoplakin II tension sensor can be co-expressed with the donor only control to determine intermolecular FRET.DepositorInserthuman Desmoplakin II (1-1353)-[YPet(short)(Y67G)-F40-mCherry] (DSP Human)
UseRetroviralTagsYPet(short)-F40-mCherry(Y72L)ExpressionMammalianMutationtruncation after aa1353; Y67G mutation in YPet(sh…PromoterCMVAvailable SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shARL4C.1
Plasmid#110320PurposeTRCN0000048179 (Target GTCCCTGCATATCGTCATGTT), silence human ARL4C gene and express monomeric Kusabira-Orange2DepositorInsertARL4C (ARL4C Human, Homo sapiens)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceAug. 20, 2018AvailabilityAcademic Institutions and Nonprofits only