We narrowed to 10,522 results for: SEC
-
Plasmid#221822PurposePlasmid to express gRNA2 (aatttcgacgggccttcaag) for editing at the end of Drosophila 5-HT1BR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only
-
pdU6-2_sgRNA1-5-HT2AR-isoformD
Plasmid#221823PurposePlasmid to express gRNA1 (tccttctggcgcaaacacgg) for editing at the end of Drosophila 5-HT2AR isoform D coding frameDepositorInsertd5-HT2AR isoform D gRNA1 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterDrosophila U6 promoterAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-5-HT2AR-isoformD
Plasmid#221824PurposePlasmid to express gRNA2 (ctgaagacataattacgtgg) for editing at the end of Drosophila 5-HT2AR isoform D coding frameDepositorInsertd5-HT2AR isoform D gRNA2 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterzebrafish U6 promoter (U6b)Available SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-5-HT2AR-isoformBFH
Plasmid#221825PurposePlasmid to express gRNA1 (cgctatcggtctgtgacaga) for editing at the end of Drosophila 5-HT2AR isoforms B, F and H coding frameDepositorInsertd5-HT2AR isoforms BFH gRNA1 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterzebrafish U6 promoter (U6b)Available SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-5-HT2AR-isoformBFH
Plasmid#221826PurposePlasmid to express gRNA2 (ggaaaagccgctaattacag) for editing at the end of Drosophila 5-HT2AR isoforms B, F and H coding frameDepositorInsertd5-HT2AR isoforms BFH gRNA2 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterDrosophila U6 promoterAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA-d5-HT7R
Plasmid#221829PurposePlasmid to express gRNA (ggcgagggagagctttctct) for editing at the end of Drosophila 5-HT1AR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYI2294
Plasmid#228352PurposeMethanol-inducible ALX-0081 expressionDepositorInsertMFalpha(2xAdv)-LE-ALX-0081-3A-FLAG-His
UseAffinity Reagent/ AntibodyTagsAAA linker followed by FLAG-His6 and MF_ secretio…ExpressionYeastPromoterKpAOX1 promoterAvailable SinceMarch 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYI2292
Plasmid#228350PurposeMethanol-inducible ALX-0171 expressionDepositorInsertMFalpha(2xAdv)-LE-ALX-0171-3A-FLAG-His
UseAffinity Reagent/ AntibodyTagsAAA linker followed by FLAG-His6 and MF_ secretio…ExpressionYeastPromoterKpAOX1 promoterAvailable SinceMarch 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYI2293
Plasmid#228351PurposeConstitutive ALX-0081 expressionDepositorInsertMFalpha(2xAdv)-LE-ALX-0081-3A-FLAG-His
UseAffinity Reagent/ AntibodyTagsAAA linker followed by FLAG-His6 and MF_ secretio…ExpressionYeastPromoterKpGAPDH promoterAvailable SinceMarch 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMT1461
Plasmid#228319PurposeDoxycycline-regulatable ALX-0081 expressionDepositorInsertMFalpha(2xAdv)-ALX-0081-3A-FLAG-His
UseAffinity Reagent/ AntibodyTagsAAA linker followed by FLAG-His6 and MF_ secretio…ExpressionYeastPromoterDoxycycline-regulatable synthetic promoter (KpTc7…Available SinceMarch 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1-PH-mCherry-Oskar 139-240 MUT (A162E/L228E) (HK202)
Plasmid#206464PurposeOskar 139-240 mut expression in Schneider cells for imagingDepositorAvailable SinceJuly 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBS-KDRT-STOP-loxP-3XP3::dsRed-loxP-STOP-KDRT-1XALFA
Plasmid#217509PurposeKD Recombinase dependent conditional 1X ALFA cassetteDepositorInsertKDRT-STOP-loxP-3XP3::dsRed-loxP-STOP-KDRT-1XALFA
TagsALFA tagExpressionInsectAvailable SinceMay 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRDB_051
Plasmid#216081Purposefor stable fly cell lines; attL and attR sequences for genome integration by phiC31, destination vectorDepositorHas ServiceCloning Grade DNAInsertattL and attR sequences for genome integration by phiC31
UseDestinationExpressionInsectAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMtnA FLAG-IntS7 puro
Plasmid#208405PurposeExpresses FLAG-tagged Drosophila IntS7 from inducible MtnA promoterDepositorAvailable SinceDec. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMtnA FLAG-IntS13 puro
Plasmid#208406PurposeExpresses FLAG-tagged Drosophila IntS13 from inducible MtnA promoterDepositorAvailable SinceDec. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMtnA FLAG-IntS14 puro
Plasmid#208407PurposeExpresses FLAG-tagged Drosophila IntS14 from inducible MtnA promoterDepositorAvailable SinceDec. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMtnA FLAG-IntS6 puro
Plasmid#195076PurposeExpresses FLAG-tagged Drosophila IntS6 from inducible MtnA promoterDepositorAvailable SinceNov. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMtnA FLAG-IntS12 puro
Plasmid#195077PurposeExpresses FLAG-tagged Drosophila IntS12 from inducible MtnA promoterDepositorAvailable SinceNov. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
pUb FLAG-IntS6 AA 1-400
Plasmid#195071PurposeExpresses FLAG-tagged Drosophila IntS6 amino acids 1-400DepositorAvailable SinceNov. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
pUb FLAG-IntS6 AA 1-600
Plasmid#195072PurposeExpresses FLAG-tagged Drosophila IntS6 amino acids 1-600DepositorAvailable SinceNov. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
pUb FLAG-IntS6 AA 101-1284
Plasmid#195073PurposeExpresses FLAG-tagged Drosophila IntS6 amino acids 101-1284DepositorAvailable SinceNov. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
pUb FLAG-IntS6 AA 1197-1284
Plasmid#195074PurposeExpresses FLAG-tagged Drosophila IntS6 amino acids 1197-1284DepositorAvailable SinceNov. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
pUb FLAG-IntS6 AA 101-1200
Plasmid#195075PurposeExpresses FLAG-tagged Drosophila IntS6 amino acids 101-1200DepositorAvailable SinceNov. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1-V5-HisB-ObKHC-K282R-HaloTag
Plasmid#201552PurposeExpresses Octopus kinesin-1 motor with K282R mutation with HaloTag in Drosophila S2 cellsDepositorInsertKinesin-1
TagsHaloTagExpressionInsectMutationchanged lysine 282 to arginine (numbering based o…PromoterAc5Available SinceNov. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMMK ENTR 3 polH aeBlue polH VSV-G
Plasmid#206278PurposeENTR Vector 3 for MultiSite Gateway assembly. Encodes aeBlue chromoprotein and VSV-G glycoprotein under the control of viral polH promoters.DepositorInsertaeBlue, VSV-G
UseMultimate/gateway entr 3ExpressionBacterial and InsectAvailable SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBVboostFGII WPRE 3C-CVB3
Plasmid#202077PurposeBacterial expression of 3C protease from coxsackievirus B3 (CVB3). Contains C-terminal His6-tag.DepositorInsertCVB3 3C protease with HisTag
Tags6xHis-tagExpressionBacterial, Insect, and Mamm…Promoterpolh, CAG, T7Available SinceAug. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
IR76b-T2A-QF2
Plasmid#162523PurposePlasmid for CRISPR-mediated knock-in line that expresses a QF2 transcriptional activator by knocking-in a T2A-QF2 fragment replacing the stop codon of the endogenous Aedes aegypti Ir76b geneDepositorInsertIr76b-left-HDR-arm; T2A-QF2-SV40; 3xP3-dsRed-SV40; Ir76b-right-HDR-arm
ExpressionInsectAvailable SinceMay 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
GR3-T2A-QF2
Plasmid#162521PurposePlasmid for CRISPR-mediated knock-in line that expresses a QF2 transcriptional activator by knocking-in a T2A-QF2 fragment replacing the stop codon of the endogenous Aedes aegypti Gr3 geneDepositorInsertGr3-left-HDR-arm; T2A-QF2-SV40; 3xP3-dsRed-SV40; Gr3-right-HDR-arm
ExpressionInsectAvailable SinceMay 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
IR8a-T2A-QF2
Plasmid#162520PurposePlasmid for CRISPR-mediated knock-in line that expresses a QF2 transcriptional activator by knocking-in a T2A-QF2 fragment replacing the stop codon of the endogenous Aedes aegypti Ir8a geneDepositorInsertIr8a-left-HDR-arm; T2A-QF2-SV40; 3xP3-dsRed-SV40; Ir8a-right-HDR-arm
ExpressionInsectAvailable SinceMay 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
pFastBac_Dual_GST-TEV-EGFP-TBK1-E696K
Plasmid#198037PurposeUsed for the expression and purification of EGFP labelled TBK1 carrying E696K mutation (SMC Internal No.: 1649)DepositorAvailable SinceApril 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1/V5-HisA-RvCAHS8-GS-AcGFP1
Plasmid#192470PurposeTransient expression of RvCAHS8 (fly codon optimized)-GS_linker-AcGFP1 in Drosophila cellsDepositorInsertCAHS8
TagsAcGFP1ExpressionInsectPromoterAc5 promoterAvailable SinceDec. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1/V5-HisA-RvCAHS3-GS-AcGFP1
Plasmid#192469PurposeTransient expression of RvCAHS3 (fly codon optimized)-GS_linker-AcGFP1 in Drosophila cellsDepositorInsertCAHS3
TagsAcGFP1ExpressionInsectPromoterAc5 promoterAvailable SinceDec. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAFMW-Nbr[R272A,K276A, R280A,K284A]
Plasmid#188599PurposeFlag-tagged Nibbler variants expression in Drosophila S2 cellsDepositorInsertNibbler (Nbr Fly)
TagsFLAG-MycExpressionInsectMutationR272A [CGG=> GCG], K276A [AAG=>GCG], R280A …Available SinceNov. 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
pFastBac-M13-6His-KIF1C_R169W-GFP
Plasmid#185979PurposeBaculovirus expression of human KIF1C with R169W mutation and 6xHis and GFP tags.DepositorInsertKIF1C (KIF1C Human)
Tags6xHis and eGFPExpressionInsectMutationR169W - mutation causing HSP (SPG58)Available SinceOct. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
-
IR25a-T2A-QF2
Plasmid#162522PurposePlasmid for CRISPR-mediated knock-in line that expresses a QF2 transcriptional activator by knocking-in a T2A-QF2 fragment replacing the stop codon of the endogenous Aedes aegypti Ir25a geneDepositorInsertIr25a-left-HDR-arm; T2A-QF2-SV40; 3xP3-dsRed-SV40; Ir25a-right-HDR-arm
ExpressionInsectAvailable SinceAug. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
-
piwi_sgRNA
Plasmid#186653Purposepiwi sgRNA plasmidDepositorInsertPiwi sgRNA Plasmid (piwi Fly)
ExpressionInsectAvailable SinceAug. 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
Nbr_C_sgRNA2
Plasmid#186664PurposeNbr C-tag sgRNA2 plasmidDepositorInsertNbr sgRNA 2 Plasmid (Nbr Fly)
ExpressionInsectAvailable SinceJuly 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
Nbr_C_sgRNA1
Plasmid#186663PurposeNbr C-tag sgRNA1 plasmidDepositorInsertNbr sgRNA 1 Plasmid (Nbr Fly)
ExpressionInsectAvailable SinceJuly 22, 2022AvailabilityAcademic Institutions and Nonprofits only