We narrowed to 9,360 results for: CAG
-
Plasmid#171504Purposedeletion of a genomic locus in Blimp1(Prdm1) geneDepositorAvailable SinceNov. 9, 2022AvailabilityAcademic Institutions and Nonprofits only
-
pX330A-Blimp1-L2-#2
Plasmid#171506Purposedeletion of a genomic locus in Blimp1(Prdm1) geneDepositorAvailable SinceNov. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
E42_control_NGFR
Plasmid#189800PurposeRetroviral delivery of control guide RNADepositorInsertLuciferase gRNA
UseRetroviralAvailable SinceOct. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
double_sgRNA targeting e1 and e4
Plasmid#190688PurposesgRNAs targeting enhancer 1 and 4 of MYC separatelyDepositorInsertsgRNAs targeting enhancer 1 and 4 of MYC separately
UseCRISPR, Lentiviral, and Synthetic BiologyTagsBFP and PuromycinExpressionMammalianAvailable SinceOct. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAc-sgRNA-Cas9.scr_1
Plasmid#190703PurposeExpresses scrambled sgRNA and Cas9-Puro in Drosophila S2 cellsDepositorInsertScrambled sgRNA 1
UseCRISPRExpressionInsectPromoterDrosophila U6Available SinceSept. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT-GFP-rG2
Plasmid#188968PurposeIPTG inducible GFP with sgRNADepositorInsertsGFP
sgRNA: agtccatgtaatcagcgtctactagt
UseSynthetic BiologyExpressionBacterialPromoterPtrcAvailable SinceSept. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCfB9341 (pgRNA_IX-1_NatMX)
Plasmid#161593PurposeEasyClone-MarkerFree guiding RNA vector to direct Cas9 to cut at site IX-1DepositorInsertguiding RNA
UseCRISPR and Synthetic BiologyExpressionYeastAvailable SinceAug. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_BRAF
Plasmid#183273PurposeAll-in-One CRISPRko system with a guide RNA that targets BRAF geneDepositorInsertBRAF
UseLentiviralAvailable SinceJuly 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
TRE-RARa-VP16
Plasmid#185561PurposeDoxycycline inducible expression of constitutively active Retinoic Acid Receptor alphaDepositorAvailable SinceJune 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_DHFR
Plasmid#183281PurposeAll-in-One CRISPRko system with a guide RNA that targets DHFR geneDepositorInsertDHFR
UseLentiviralAvailable SinceJune 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_FLT1
Plasmid#183292PurposeAll-in-One CRISPRko system with a guide RNA that targets FLT1 geneDepositorInsertFLT1
UseLentiviralAvailable SinceJune 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
1056D
Plasmid#183132PurposePlasmid supports expression of 2 gRNAs targeting D.suzukii bTub, Opie-mVenus tagged, and can be integrated with pBac.DepositorInsertU6.3-gRNAs[bTub]
UseCRISPRExpressionInsectAvailable SinceJune 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
1056F
Plasmid#183134PurposePlasmid supports expression of 2 gRNAs targeting D.suzukii tra, Opie-mVenus tagged, and can be integrated with pBac.DepositorInsertU6.3-gRNAs[tra]
UseCRISPRExpressionInsectAvailable SinceJune 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_SMO
Plasmid#183321PurposeAll-in-One CRISPRko system with a guide RNA that targets SMO geneDepositorInsertSMO
UseLentiviralAvailable SinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_RET
Plasmid#183319PurposeAll-in-One CRISPRko system with a guide RNA that targets RET geneDepositorInsertRET
UseLentiviralAvailable SinceMay 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_PSMB5
Plasmid#183317PurposeAll-in-One CRISPRko system with a guide RNA that targets PSMB5 geneDepositorInsertPSMB5
UseLentiviralAvailable SinceMay 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_MET
Plasmid#183310PurposeAll-in-One CRISPRko system with a guide RNA that targets MET geneDepositorInsertMET
UseLentiviralAvailable SinceMay 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_LCK
Plasmid#183307PurposeAll-in-One CRISPRko system with a guide RNA that targets LCK geneDepositorInsertLCK
UseLentiviralAvailable SinceMay 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_CSF3R
Plasmid#183278PurposeAll-in-One CRISPRko system with a guide RNA that targets CSF3R geneDepositorInsertCSF3R
UseLentiviralAvailable SinceMay 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_BCL2
Plasmid#183272PurposeAll-in-One CRISPRko system with a guide RNA that targets BCL2 geneDepositorInsertBCL2
UseLentiviralAvailable SinceMay 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_AR
Plasmid#183271PurposeAll-in-One CRISPRko system with a guide RNA that targets AR geneDepositorInsertAR
UseLentiviralAvailable SinceMay 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_ADA
Plasmid#183269PurposeAll-in-One CRISPRko system with a guide RNA that targets ADA geneDepositorInsertADA
UseLentiviralAvailable SinceMay 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pOC4 Kcnn2-smFP-myc KI
Plasmid#183438PurposeFlpON knock-in for SK2-smFP-myc (amino acid position: T571)DepositorInsertgRNA and smFP myc donor
UseCRISPRExpressionMammalianAvailable SinceApril 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pOC5 smFP-HA-Cacna1e KI
Plasmid#183441PurposeFlpOFF knock-in for smFP-HA-CaV2.3 (amino acid position: G5)DepositorInsertgRNA and smFP HA donor
UseCRISPRAvailable SinceApril 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pOC2 Gria1-Halo KI
Plasmid#183433PurposeCreOFF knock-in for GluA1-Halo (amino acid position: stop codon)DepositorInsertgRNA and Halo donor
UseCRISPRAvailable SinceApril 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pOC4 Grin1-smFP-V5 KI
Plasmid#183439PurposeFlpON knock-in for GluN1-smFP-V5 (amino acid position: A20)DepositorInsertgRNA and smFP V5 donor
UseCRISPRExpressionMammalianAvailable SinceApril 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pOC2 Gria1-GFP KI
Plasmid#183430PurposeCreOFF knock-in for GluA1-GFP (amino acid position: stop codon)DepositorInsertgRNA and GFP donor
UseCRISPRAvailable SinceApril 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX458_sgRNA_Ago1_5
Plasmid#172470PurposeExpresses SpCas9, GFP, and sgRNA targeting Ago1DepositorInsertsgAgo1
UseCRISPRExpressionMammalianPromoterhU6Available SinceMarch 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
Pb mD3S4-dN
Plasmid#180252PurposeP. berghei D3 (502-617) construct with N516T, S533N and N539Q mutations to abolish N-glycosylation was used for crystallization.DepositorInsertD3 of P. berghei HAP2 with N-glycosylation sites mutated
Tags6HisExpressionMammalianMutationN516T, S533N and N539QAvailable SinceMarch 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDD2706
Plasmid#175080PurposeMammalian expression of Flag-tagged KSHV ORF45 RC mutantDepositorInsertKSHV ORF45 (ORF45 Kaposi's sarcoma-associated herpesvirus 8)
ExpressionMammalianMutationRC mutant; sequence mutation: GCGGCCGCAGCGCAAvailable SinceFeb. 8, 2022AvailabilityAcademic Institutions and Nonprofits only