We narrowed to 9,399 results for: bli
-
Plasmid#195177PurposeVector for transient expression of MSRA gene with C-terminal HA tag, gene flanked by att sites for gateway cloningDepositorAvailable SinceFeb. 20, 2024AvailabilityAcademic Institutions and Nonprofits only
-
YIp204-PADH1-atTIR1-9myc
Plasmid#99532PurposeS. cerevisiae expression of F-box protein TIR1-9myc under control of the ADH1 promoter, TRP1 marker (for use with the AID degron system)DepositorAvailable SinceSept. 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-CTSL
Plasmid#158444PurposeGateway Cloning compatible entry vector for the human CTSL gene.DepositorInsertCTSL (CTSL Human)
UseGateway entry vectorAvailable SinceAug. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEF274 SVAfw
Plasmid#178192PurposeThe SVA (SINE-VNTR-ALU) retroposon that causes human X-linked Dystonia Parkinsonism (XDP), within a BAC (pJazz) backbone.DepositorInsertSVA that inserts into the X-linked human TAF1 gene to cause X-linked dystonia Parkinsonism
UseLinear bac vectorAvailable SinceMarch 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
GFP-ATG8(416)/GFP-AUT7(416)
Plasmid#160389PurposeExpresses ATG8 fused at the N terminus to GFP under the control of the endogenous promoter , NAT selectionDepositorInsertautophagy-related 8 (ATG8 Budding Yeast)
UseCen/arsExpressionYeastPromoterEndogenous ATG8 promoterAvailable SinceDec. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
CROPseq-EFS-HypaSpCas9-P2A-puro
Plasmid#106965Purposesingle-vector CROPseq system with high fidelity SpCas9 (HypaSpCas9) for use in the CROPseq CRISPR knockout screenDepositorInsertHypaSpCas9
UseCRISPR and LentiviralExpressionMammalianPromoterEFSAvailable SinceApril 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
M3-PAmcherry1
Plasmid#114189Purposestudying clustering of M3 receptors by superresolution microscopy (PALM)DepositorInsertMuscarin acetylcholine receptor 3 (CHRM3 Human)
Tags3xHA and PAmCherryExpressionMammalianPromoterSV40Available SinceOct. 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMT-IMD-V5-His
Plasmid#63748PurposeExpresses drosophila IMD tagged with V5 and 6xHis epitopes, under control of metallothionein promoterDepositorInsertimmune deficiency (imd Fly)
TagsV5-6XHisExpressionInsectMutation*see comment belowPromoterpMTAvailable SinceApril 7, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-con/fon DREADD Gq-mCherry
Plasmid#200661PurposeConstruct for chemogenetically activating and visualizing subpopulations of neurons in the retinaDepositorInsertDREADD Gq-mCherry
UseAAV, Cre/Lox, and Mouse Targeting ; IntrsectTagsmCherryExpressionMammalianPromoterhSynAvailable SinceNov. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHR_EF1a_flagLaM4-Notch-Gal4VP64
Plasmid#216669PurposeExpresses anti-mCherry synNotch Gal4VP64DepositorInsertanti-mCherry synNotch Gal4VP64
ExpressionMammalianAvailable SinceNov. 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCDNA5 FRT TO FLAG LRRK1
Plasmid#232062PurposeExpresses FLAG-LRRK1 in mammalian cellsDepositorAvailable SinceFeb. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
-
pLenti6.2_mCherry_ mito_roGFP2-Orp1
Plasmid#155042PurposeFluorescent redox reporterDepositorInsertOrp1 (HYR1 Budding Yeast)
UseLentiviralTagsmitochondrial targeting sequence and roGFP2ExpressionMammalianPromoterCMVAvailable SinceOct. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV hSyn GFP-Cre
Plasmid#175381Purposeexpresses GFP-Cre under the control of a human synapsin promoterDepositorInsertGFP-Cre recombinase
UseAAVTagsCre is fused to GFP. GFP is fused to additional n…Promoterhuman synapsinAvailable SinceNov. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAGM4723:Ble:Cas9
Plasmid#112208PurposeGolden Gate Level 2 construct encoding Cas9-YFP, Zeocin resistance.DepositorInsertsCas9
SheBle
UseCRISPR; Diatom, phaeodactylumTagsPhaeodactylum fcp promoter and terminator and YFPMutationPhaeodactylum Fcp promoterPromoterPhaeodactylum FcpAvailable SinceJuly 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTRIPZ (M)-HT-Cbx2
Plasmid#82510PurposeExpresses Halotag-Cbx2 fusion proteins in mammalian cellsDepositorInsertChromobox Homolog 2 (CBX2 Human)
UseLentiviralTagsHaloTagExpressionMammalianPromoteraggcgtgtacggtgggaggcctatataagcagagctcgtttagtgaacc…Available SinceDec. 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pNL [NlucP/STAT5-RE/Hygro] Vector
Plasmid#236819PurposeExpress STAT5 response element in luciferase reporter assayDepositorHas ServiceDNAInsertSTAT5 (STAT5A Human)
UseLuciferaseTagsNanoLuc (R)MutationNonePromoterminPAvailable SinceJuly 14, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
NPY-GFP
Plasmid#74629Purposehuman neuropeptide Y fused to GFPDepositorAvailable SinceApril 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
pRK5-EGFR
Plasmid#65225PurposeExpression of EGFR in mammalian cellsDepositorAvailable SinceNov. 7, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCDH-CB-iCre-P2A-tdTomato-T2A-Puro
Plasmid#72255PurposeExpress iCre, tdTomato and puromycin resistance gene (puromycin N-acetyl-transferase) under CB (chicken beta-actin + CMV enhancer) promoterDepositorInsertiCre-P2A-tdTomato-T2A-Puro
UseLentiviralExpressionMammalianPromoterCB and chicken beta-actin + CMV enhancerAvailable SinceMarch 1, 2017AvailabilityAcademic Institutions and Nonprofits only