We narrowed to 23,913 results for: promoter
-
Plasmid#166952PurposeLentiviral plasmid expressing HA-tagged KIF5A protein with IRES-Puro from the EF1a promoterDepositorAvailable SinceMarch 24, 2021AvailabilityAcademic Institutions and Nonprofits only
-
AAV-Nppa-EGFP
Plasmid#247327PurposeExpresses EGFP under the control of the Nppa promoterDepositorInsertEGFP under the control of the Nppa Promoter
UseAAVExpressionMammalianPromoterNppa proximal promoterAvailable SinceNov. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 38t3 thsS(t3)R-bARGSer
Plasmid#232468PurposeOptimized thiosulfate sensor with acoustic reporter genes (bARGSer)DepositorInsertsthsS(t3)
thsR
PphsA342
bARGSer
AxeTxe
ExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23104 (ttgacagctagctcagtcctaggtattgtgctagc), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
TOPO-EXOC3 (-1557 to-1046)
Plasmid#226446PurposeFor subcloning of human EXOC3 promoter (base pairs -1557 to-1046) or for assays using M13 phageDepositorAvailable SinceSept. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
TOPO-EXOC3 (-2455 to -1951)
Plasmid#226441PurposeFor subcloning of human EXOC3 promoter (base pairs -2455 to -1951) or for assays using M13 phageDepositorAvailable SinceJuly 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
TOPO-EXOC3 (-1592 to -1046)
Plasmid#226444PurposeFor subcloning of human EXOC3 promoter (base pairs -1592 to -1046) or for assays using M13 phageDepositorAvailable SinceJuly 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
TOPO-EXOC3 (-1591 to -1009)
Plasmid#226443PurposeFor subcloning of human EXOC3 promoter (base pairs -1591 to -1009) or for assays using M13 phageDepositorAvailable SinceJuly 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
TOPO-EXOC3 (-1701 to -1594)
Plasmid#226442PurposeFor subcloning of human EXOC3 promoter (base pairs -1701 to -1594) or for assays using M13 phageDepositorAvailable SinceJuly 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
TOPO-EXOC3 (-1592 to -1444)
Plasmid#226445PurposeFor subcloning of human EXOC3 promoter (base pairs -1592 to -1444) or for assays using M13 phageDepositorAvailable SinceJuly 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
TOPO-EXOC3 (-1557 to-1444)
Plasmid#226447PurposeFor subcloning of human EXOC3 promoter (base pairs -1557 to-1444) or for assays using M13 phageDepositorAvailable SinceJuly 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBC001 v3
Plasmid#161711PurposeCMVp-EGFP-[barcode cloning site]-PGKp-Puro-WPREDepositorTypeEmpty backboneUseLentiviral and Synthetic BiologyExpressionMammalianPromoterCMV PromoterAvailable SinceJuly 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMT1219
Plasmid#228301Purpose2,4-Diacetylphloroglucinol (DAPG)-regulatable expression of SARS-CoV-2 RBD omicron variantDepositorInsertMFalpha(2xAdv)-SARS CoV-2 receptor binding domain (RBD)-His (S Severe acute respiratory syndrome-related coronavirus 2, Synthetic)
UseSynthetic BiologyTagsGGG linker followed by His6 and MF_ secretion sig…ExpressionYeastMutationG339D, S371L, S373P, S375F, K417N, N440K, G446S, …Promoter2,4-Diacetylphloroglucinol-regulatable synthetic …Available SinceMarch 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
PGL4.11-COL1A1mTEAD
Plasmid#230916PurposeComparing with wild type COL1A1 promoter, tested whether mutant TEAD binding sites changed the promoter activity.DepositorInsertHuman COL1A1 promoter with mutant TEAD elements (COL1A1 Human)
UseLuciferaseTagsLuciferase- luc2pExpressionBacterial and MammalianMutationmutant potential TEAD bind elements AGGAAT to CTG…PromoterCOL1A1Available SinceFeb. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-EF1a-KIF5AR280H-HA-IRES-Puro
Plasmid#166953PurposeLentiviral plasmid expressing HA-tagged KIF5A R280H protein with IRES-Puro from the EF1a promoterDepositorAvailable SinceMarch 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-dCas9-p300 Core (C1204R)
Plasmid#61361Purposeencodes S. pyogenes dCas9 with c-terminal fusion of human p300 HAT core (aa 1048-1664; mutation C1204R) driven by CMV promoterDepositorInsertS.pyogenes dCas9 with c-terminal human p300 Core effector fusion (aa 1048-1664 of human p300) (EP300 S. pyogenes, Synthetic, Human)
UseCRISPR and Synthetic BiologyTagsFlag, HA, and SV40 NLSExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9; C1204R mutation i…PromoterCMVAvailable SinceApril 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
bActin-RSG-BiSKi
Plasmid#26437DepositorInsertbActin promoter
Use4726Available SinceMarch 23, 2012AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-hRARβ.hRXRα
Plasmid#135415PurposeHuman Retinoic Acid Receptor-beta and Human Retinoid X Receptor-alpha in pcDNA3.1(+) plasmid expression vectorDepositorInsertsHuman retinoic acid receptor-beta
Human retinoid X receptor-alpha
ExpressionMammalianPromoterCMV and SV40Available SinceJan. 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-hRARα.hRXRα
Plasmid#135411PurposeHuman Retinoic Acid Receptor-alpha and Human Retinoid X Receptor-alpha in pcDNA3.1(+) plasmid expression vectorDepositorInsertsHuman retinoic acid receptor-alpha
Human retinoid X receptor-alpha
ExpressionMammalianPromoterCMV and SV40Available SinceJan. 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-hRARγ.hRXRα
Plasmid#135416PurposeHuman Retinoic Acid Receptor-gamma and Human Retinoid X Receptor-alpha in pcDNA3.1(+) plasmid expression vectorDepositorInsertsHuman retinoic acid receptor-gamma
Human retinoid X receptor-alpha
ExpressionMammalianPromoterCMV and SV40Available SinceJan. 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
hOC-GFPtpz
Plasmid#110207PurposeExpresses GFP in mature bone cells.DepositorInserteGFPtopaz
TagsNoneExpressionMammalianPromoterHuman osteocalcin (BGLAP)Available SinceJune 18, 2018AvailabilityAcademic Institutions and Nonprofits only