We narrowed to 4,433 results for: chm
-
Plasmid#158603PurposePlasmid expressing KB-1753-Nluc in mammalian cellsDepositorInsertmyristic acid attachment peptide (mas; MGSSKSKTSNS) - linker(GIKLGG) - KB1753 - linker (GGTGGS) - Nluc
ExpressionMammalianPromoterCMVAvailable SinceSept. 30, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pU6-Sp-gRNA-ALB_DF_B358c_attB
Plasmid#182146PurposeTo insert attB attachment site at ALB in human cells via twinPEDepositorInsertALB_B358c_attB pegRNA
ExpressionMammalianPromoterhU6Available SinceMarch 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pU6-Sp-gRNA-ALB_DF_A277c_attB
Plasmid#182145PurposeTo insert attB attachment site at ALB in human cells via twinPEDepositorInsertAlb_A277c_attB pegRNA
ExpressionMammalianPromoterhU6Available SinceMarch 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCS4134
Plasmid#131747PurposeHuman reduced folate transporter 1 SLC19A1 for lentiviral transduction, copGFP transduction markerDepositorAvailable SinceJune 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR sgSLC19A1
Plasmid#102314Purposegenetic depletion of SLC19A1DepositorAvailable SinceJuly 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pME-hygro-hPGAP3-3HA
Plasmid#50373PurposeExpress C-terminally triple HA tagged human PGAP3 in mammmalian cellsDepositorInsertPGAP3 post-GPI attachment to proteins 3 (PGAP3 Human)
Tags3x HAExpressionMammalianPromoterSR alphaAvailable SinceJuly 15, 2014AvailabilityAcademic Institutions and Nonprofits only -
pU6-Sp-gRNA-IDS2_DF_A4b_attP_fwd
Plasmid#182149PurposeTo insert attP-fwd attachment site at IDS2 in human cells via twinPEDepositorInsertIDS2-A4b-attP-fwd pegRNA
ExpressionMammalianPromoterhU6Available SinceMarch 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pU6-Sp-gRNA-IDS_DF_D1b_attB_rev
Plasmid#182152PurposeTo insert attB-rev attachment site at IDS in human cells via twinPEDepositorInsertIDS-D1b-attB-rev pegRNA
ExpressionMammalianPromoterhU6Available SinceMarch 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pU6-Sp-gRNA-IDS_DF_C2c_attB_rev
Plasmid#182151PurposeTo insert attB-rev attachment site at IDS in human cells via twinPEDepositorInsertIDS-C2c-attBrev pegRNA
ExpressionMammalianPromoterhU6Available SinceMarch 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pU6-Sp-gRNA-IDS2_DF_B7b_attP_fwd
Plasmid#182150PurposeTo install attP-fwd attachment site at IDS2 in human cells via twinPEDepositorInsertIDS2-B7b-attP-fwd pegRNA
ExpressionMammalianPromoterhU6Available SinceMarch 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pA-RFP-rG2
Plasmid#188969PurposeIPTG inducible mCherry with sgRNADepositorInsertsmCherry
sgRNA: agtccatgtaatcagcgtctactagt
UseSynthetic BiologyExpressionBacterialPromoterPtrcAvailable SinceSept. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-mas-PRGRH-Nluc
Plasmid#158608PurposePlasmid expressing PRG(RH)-Nluc in mammalian cellsDepositorInsertmyristic acid attachment peptide (mas; MGSSKSKTSNS) - linker (GIKLGG) - PDZ RhoGEF RH domain - linker (GGTGGS) - Nluc
ExpressionMammalianPromoterCMVAvailable SinceJuly 20, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pcDNA3.1-mas-p115RH-Nluc
Plasmid#158607PurposePlasmid expressing p115(RH)-Nluc in mammalian cellsDepositorInsertmyristic acid attachment peptide (mas; MGSSKSKTSNS) - linker (GIKLGG) - p115RhoGEF RH domain - linker (GGTGGS) - Nluc
ExpressionMammalianPromoterCMVAvailable SinceJune 29, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
BII-C3H2B
Plasmid#133387PurposePiggybac vector for SRIRACCHA-mediated mutation enrichment (surrogate target for HDR)DepositorTypeEmpty backboneExpressionMammalianPromoterCMV enhancer and hEf1a (CpG free)Available SinceJan. 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
SpyDock
Plasmid#124618PurposeExpresses SpyDock to bind SpyTag non-covalently for affinity purificationDepositorInsertSpyDock
TagsHis6ExpressionBacterialMutationE77A mutation prevents isopeptide bond formation,…PromoterT7Available SinceMay 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCGN-ATF6 (1-373)
Plasmid#27173PurposeFor mammalian expression of the cytoplasmic domain of human ATF6with an HA tag.DepositorInsertATF6 (ATF6 Human)
TagsHAExpressionMammalianMutationContains only aa 1-373 (please see depositor comm…Available SinceJan. 5, 2011AvailabilityAcademic Institutions and Nonprofits only -
mEos3.2GPI
Plasmid#203759PurposeEncodes the fluorescent protein mEos3.2 followed by the C-terminal sequence derived from CD58 encoding a GPI-attachment signal. Used as a fluorescent plasma membrane probe.DepositorAvailable SinceAug. 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEA02
Plasmid#172193PurposeSuicide vector carrying the site attL of the SSR system of pSAM2. This plasmid is integrated into the genome of Actinobacteria by HR when carrying a DNA fragment identical to a region of the genome.DepositorInsertattL
ExpressionBacterialAvailable SinceSept. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEA03
Plasmid#172194PurposeSuicide vector carrying the site attR of the SSR system of pSAM2. This plasmid is integrated into the genome of Actinobacteria by HR when carrying a DNA fragment identical to a region of the genome.DepositorInsertattR
ExpressionBacterialAvailable SinceSept. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-mas-KB-1753-Nluc I9A/W10A
Plasmid#158604PurposePlasmid expressing KB-1753-Nluc I9A/W10A in mammalian cellsDepositorInsertmyristic acid attachment peptide (mas; MGSSKSKTSNS) - linker(GIKLGG) - KB1753 I9A/W10A - linker (GGTGGS) - Nluc
ExpressionMammalianPromoterCMVAvailable SinceJune 29, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits