We narrowed to 4,407 results for: crispr c plasmids
-
Plasmid#183912PurposegRNA-expressing plasmid under Aedes aegypti AAEL017702 U6 promoterDepositorInsertgRNA scaffold for protospacer cloning into BbsI sites
PromoterAedes aegypti U6 promoter (AAEL017702)Available sinceAug. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pKSB-AeU6-2gRNA
Plasmid#183913PurposegRNA-expressing plasmid under Aedres aegypti AAEL017774 U6 promoterDepositorInsertgRNA scaffold for protospacer cloning into BbsI sites
PromoterAedes aegypti U6 promoter (AAEL017774)Available sinceAug. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAV-CMV-scFVtet1_bGHpA
Plasmid#177351PurposeAAV expression of scFV-fused catalytic domain of TET1 for targeted DNA methylation editingDepositorInsertTet Methylcytosine Dioxygenase 1 (TET1 Human)
UseAAVTagsmyc and scFVExpressionMammalianMutationN terminal domain of human Tet1PromoterCMV promoterAvailable sinceSept. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-CMV-scFVtet2_bGHpA
Plasmid#177352PurposeAAV expression of scFV-fused catalytic domain of TET2 for targeted DNA methylation editingDepositorInsertTet Methylcytosine Dioxygenase 2 (TET2 Human)
UseAAVTagsmyc and scFVExpressionMammalianMutationCatalytic domains of human TET2 (1129–1936 and 14…PromoterCMV promoterAvailable sinceSept. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
PiggyBac EF1a-eGFP-Puro U6 MMP2 g2
Plasmid#170825PurposePiggyBac Cas13d sgRNA plasmid for MMP2 knockdownDepositorInsertCas13d MMP2 gRNA2
UsePiggybac transposonExpressionMammalianPromoterU6Available sinceJuly 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
PiggyBac EF1a-eGFP-Puro U6 ANXA2 g1
Plasmid#170826PurposePiggyBac Cas13d sgRNA plasmid for ANXA2 knockdownDepositorInsertCas13d ANXA2 gRNA1
UsePiggybac transposonExpressionMammalianPromoterU6Available sinceJuly 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
PiggyBac EF1a-eGFP-Puro U6 ANXA2 g2
Plasmid#170827PurposePiggyBac Cas13d sgRNA plasmid for ANXA2 knockdownDepositorInsertCas13d ANXA2 gRNA2
UsePiggybac transposonExpressionMammalianPromoterU6Available sinceJuly 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
PiggyBac EF1a-eGFP-Puro U6 CLCN3 g1
Plasmid#170828PurposePiggyBac Cas13d sgRNA plasmid for CLCN3 knockdownDepositorInsertCas13d CLCN3 gRNA1
UsePiggybac transposonExpressionMammalianPromoterU6Available sinceJuly 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
UCK2_Deletion_gRNA_1
Plasmid#204672PurposeDual gRNA plasmid for UCK2 deletionDepositorAvailable sinceMarch 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
UCK2_Deletion_gRNA_2
Plasmid#204673PurposeDual gRNA plasmid for UCK2 deletionDepositorAvailable sinceMarch 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGW004_pAAV-hU6-SapI-hTBG-Fluc-P2A-Cre
Plasmid#256631PurposeAAV vector for delivery of Cas9 guide and expressing Fluc and Cre using hTBG promoterDepositorTypeEmpty backboneUseAAVAvailable sinceJune 9, 2026AvailabilityAcademic Institutions and Nonprofits only -
pAAV_Donor/Reporter-COL4A3
Plasmid#130279PurposeCOL4A3 mutation-specific sgRNA under the control of U6 promoter; mCherry-sgRNA target-(out of frame)EGFP expression cassette; COL4A3 donor templateDepositorInsertmCherry-eGFP
UseAAVPromoterCMVAvailable sinceDec. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSEVA63_Helper
Plasmid#190432PurposeM13 helper genes cloned into the pSEVA631 vector. This plasmid does not carry an M13 packaging signal. (This plasmid is a gift of the Jaramillo Lab, where it is called PAJ297.)DepositorInsertM13 genes: I-XI
UseSynthetic BiologyAvailable sinceDec. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
RNF168 C-terminal sgRNA
Plasmid#207100PurposepX330 based plasmid for expression of Cas9 and the GAGATGCACAAAGTAAGGCC sgRNA to target the RNF168 locus.DepositorInsertGAGATGCACAAAGTAAGGCC
ExpressionMammalianPromoterCMV and U6Available sinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
RIF C-terminal sgRNA
Plasmid#207096PurposepX330 based plasmid for expression of Cas9 and the AATACTAAATAGAATTTTCA sgRNA to target the RIF1 locus.DepositorInsertAATACTAAATAGAATTTTCA
ExpressionMammalianPromoterCMV and U6Available sinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
NBS1 C-terminal sgRNA
Plasmid#207092PurposepX330 based plasmid for expression of Cas9 and the TAAAAAGGAGAAGATAACTG sgRNA to target the NBS1 locus.DepositorInsertTAAAAAGGAGAAGATAACTG
ExpressionMammalianPromoterCMV and U6Available sinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-CMV-scFVDnmt3A_bGHpA
Plasmid#177349PurposeAAV expression of scFV-fused catalytic domain of Dnmt3a for targeted DNA methylation editingDepositorInsertcatalytic domain of DNA Methyltransferase 3 Alpha (Dnmt3a Mouse)
UseAAVTagsmyc and scFVExpressionMammalianMutation598–908 aa of mouse Dnmt3aPromoterCMVAvailable sinceSept. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-hSyn-scFVtet2_bGHpA
Plasmid#177353PurposeAAV expression of scFV-fused catalytic domain of TET2 from Synapisin promoter for targeted DNA methylation editingDepositorInsertTet Methylcytosine Dioxygenase 2 (TET2 Human)
UseAAVTagsmyc and scFVExpressionMammalianMutationCatalytic domains of human TET2 (1129–1936 and 14…Promoterhuman Synapsine promoterAvailable sinceSept. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKT07_AAV-hU6-AsDR-crTSG1-EFS-Cre-T2A-hNGFR
Plasmid#256630PurposeAAV vector for delivery of AsCas12a crTSG1 guide array and expressing Cre using EFS promoterDepositorInsertcrTrp53, crPten, crApc, crRb1
UseAAVPromoterhumanU6, EFS-NSAvailable sinceJune 9, 2026AvailabilityAcademic Institutions and Nonprofits only -
pKT07_AAV-hU6-AsDR-EFS-Cre-T2A-hNGFR
Plasmid#256629PurposeAAV vector for delivery of AsCas12a guides and expressing Cre and hNGFR using EFS promoterDepositorTypeEmpty backboneUseAAVAvailable sinceJune 9, 2026AvailabilityAcademic Institutions and Nonprofits only