We narrowed to 4,353 results for: erf
-
Plasmid#91837PurposeLuciferase reporter for IL2RA enhancer (IGI-P0614)DepositorInsertIL2RA CaRE1 (plus strand) (IL2RA Human)
UseLuciferaseTagsExpressionMammalianMutationPerfect match to reference sequencePromoterAvailable SinceMay 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDONR223-PRKR
Plasmid#23452DepositorInsertPRKR (EIF2AK2 Human)
UseGateway donor vectorTagsExpressionMutationaa494-511 missingPromoterAvailable SinceJuly 30, 2010AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23-IL2RA CaRE5 (plus strand)
Plasmid#91841PurposeLuciferase reporter for IL2RA enhancer (IGI-P0618)DepositorInsertIL2RA CaRE5 (plus strand) (IL2RA Human)
UseLuciferaseTagsExpressionMammalianMutationPerfect match to reference sequencePromoterAvailable SinceJune 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23-IL2RA CaRE5 (minus strand)
Plasmid#91836PurposeLuciferase reporter for IL2RA enhancer (IGI-P0613)DepositorInsertIL2RA CaRE5 (minus strand) (IL2RA Human)
UseLuciferaseTagsExpressionMammalianMutationPerfect match to reference sequencePromoterAvailable SinceMay 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pBOBI C-MYC GAC F7
Plasmid#227828PurposeTo amplify the virus that expresses C-MYC GAC F7 with 33 residues mutated to alanine at the interface for interacting with PDZD8DepositorInsertGAC isoform of F7 (GLS Human)
UseLentiviralTagsMYCExpressionMammalianMutationP137, L139, E140, L142, Y145, G150, Q151, E152, K…PromoterAvailable SinceOct. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 93C1 thsS(t3)R-Bxb1_P7-bARGSer
Plasmid#232469PurposeOptimized thiosulfate sensor with recombinase switch and acoustic reporter genes (bARGSer)DepositorInsertsthsS(t3)
thsR
PphsA342
bARGSer
AxeTxe
Bxb1 integrase
UseTagsssrA degradation tagExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23104 (ttgacagctagctcagtcctaggtattgtgctagc), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGEX GAC F7
Plasmid#227829PurposeTo express in E. coli GAC F7 with 33 residues mutated to alanine at the interface for interacting with PDZD8DepositorInsertGAC isoform of F7 (GLS Human)
UseTagsGSTExpressionBacterialMutationP137, L139, E140, L142, Y145, G150, Q151, E152, K…PromoterAvailable SinceJuly 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHM1 KGA-33A
Plasmid#227836PurposeUsed for microinjection of nematodes for expression of KGA-33A, GLS with 33 residues mutated to alanine at the interface for interacting with PDZD8DepositorInsertKGA isoform (GLS Human)
UseTagsGFPExpressionWormMutationP137, L139, E140, L142, Y145, G150, Q151, E152, K…PromoterAvailable SinceJuly 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGEX KGA F7
Plasmid#227822PurposeTo express in E. coli KGA F7 with 33 residues mutated to alanine at the interface for interacting with PDZD8DepositorInsertKGA isoform of F7 (GLS Human)
UseTagsGSTExpressionBacterialMutationP137, L139, E140, L142, Y145, G150, Q151, E152, K…PromoterAvailable SinceJune 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBOBI C-MYC KGA F7
Plasmid#227821PurposeTo amplify the virus that expresses C-MYC KGA F7 with 33 residues mutated to alanine at the interface for interacting with PDZD8DepositorInsertKGA isoform of F7 (GLS Human)
UseLentiviralTagsMYCExpressionMammalianMutationP137, L139, E140, L142, Y145, G150, Q151, E152, K…PromoterAvailable SinceJune 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-IFIT5_K206R-VA
Plasmid#191224PurposeLentiviral expression of human IFIT5_K206R in mammalian cellsDepositorInsertinterferon-induced protein with tetratricopeptide repeats 5 (IFIT5 Human)
UseLentiviralTags3xFlag-TEVx2-6xHis-Strep x2 tag and VA tagExpressionMammalianMutationchanged Lysine 206 to Arginine (K206R)PromoterCMVAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23-IL2RA CaRE1 (minus strand)
Plasmid#91838PurposeLuciferase reporter for IL2RA enhancer (IGI-P0615)DepositorInsertIL2RA CaRE1 (minus strand) (IL2RA Human)
UseLuciferaseTagsExpressionMammalianMutationPerfect match to reference sequencePromoterAvailable SinceMay 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
Lenti-(BB)-hPGK-KRAB-dCas9-P2A-BlastR
Plasmid#118155PurposeCatalytically inactive Cas9 from S. pyogenes with P2A-BlastR under the hPGK promoter, and cloning backbone for sgRNA. Contains BsmBI sites for insertion of spacer sequences.DepositorInsertKRAB-dCas9-P2A-BlastR
UseCRISPR and LentiviralTagsHAExpressionMammalianMutationPromoterhPGK and U6Available SinceMay 6, 2019AvailabilityAcademic Institutions and Nonprofits only