We narrowed to 14,123 results for: cas9
-
Plasmid#52522Purposeexpresses a myc-tagged version of hCas9 in DrosophilaDepositorInsertS. pyogenes cas9 with humanized codon bias
TagsmycExpressionInsectPromotertubulinAvailable SinceApril 22, 2014AvailabilityAcademic Institutions and Nonprofits only -
pHRdSV40_scFv_GCN4_sfGFP-VPR-GB1_NLS
Plasmid#79373PurposeRecruits VPR to a compatible Cas9 protein for transcriptional activationDepositorInsertGCN4-sfGFP-VPR
UseCRISPRExpressionMammalianAvailable SinceOct. 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
pHRdSV40_scFv_GCN4_sfGFP_p65-hsf1_GB1_NLS
Plasmid#79372PurposeRecruits p65-hsf1 to a compatible Cas9 protein for transcriptional activationDepositorInsertGCN4-sfGFP-p65-hsf1
UseCRISPRExpressionMammalianAvailable SinceMarch 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAGM65905
Plasmid#153217PurposeLevel 2 cloning vector for one or several guide RNAs, already contains Cas9 and a kanamycin selection cassette for plant transformationDepositorTypeEmpty backboneUseCRISPRExpressionPlantAvailable SinceAug. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
YE1-BE4max-CP1028
Plasmid#138160PurposeC-to-T base editorDepositorInsertrAPOBEC1(YE1)-nSpCas9 (CP1028) -UGI-UGI
TagsNLSExpressionMammalianMutationWithin rAPOBEC1 W90Y + R126E; within Cas9 (CP1028…PromoterCMVAvailable SinceFeb. 19, 2020AvailabilityAcademic Institutions and Nonprofits only -
EE-BE4max
Plasmid#138158PurposeC-to-T base editorDepositorInsertrAPOBEC1(EE)-nSpCas9-UGI-UGI
TagsNLSExpressionMammalianMutationWithin rAPOBEC1 R126E + R132E; within Cas9 D10APromoterCMVAvailable SinceFeb. 19, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAGM55297
Plasmid#153213PurposeLevel 2 cloning vector for a single guide RNA, already contains Cas9, Kanamycin selection cassette for plant transformation and FAST markerDepositorTypeEmpty backboneUseCRISPRExpressionPlantAvailable SinceAug. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMpGE_En01
Plasmid#71534PurposeUsed to construct a gRNA expression cassette for CRISPR/Cas9 genome editing in Marchantia polymorphaDepositorTypeEmpty backboneUseCRISPRAvailable SinceDec. 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
tdTomato/pTREX-b
Plasmid#68709PurposeExpresses tdTomato in pTREX-b vector which confers resistance to blasticidin. This vector is used for cloning a specific sgRNA by BamHI, to transfect Cas9-expressing Trypanosoma cruzi epimastigotes.DepositorInserttdTomato
UseExpression of tdtomato red fluorescence protein i…Available SinceOct. 8, 2015AvailabilityIndustry, Academic Institutions, and Nonprofits -
pTX209
Plasmid#89269PurposeExpress STU Cas9 with Maize Ubiquitin1 promoter in rice targeting OsPDS gene, OsPDS-gRNA01 and OsPDS-gRNA02DepositorInsertOsPDS-gRNA01 and OsPDS-gRNA02
UseCRISPRTagsSV40 NLSExpressionPlantPromoterMaize Ubiquitin1 promoterAvailable SinceMay 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
MSP2283
Plasmid#70702PurposeBacterial expression plasmid for SaCas9 & sgRNA targeted to site 1: T7-humanSaCas9-NLS-3xFLAG-T7-Sa-sgRNA(84) #1DepositorInsertsmammalian codon-optimized Staphylococcus aureus Cas9
SaCas9 sgRNA (+84)
UseCRISPRTagsNLS-3xFLAGExpressionBacterialPromoterT7Available SinceDec. 4, 2015AvailabilityAcademic Institutions and Nonprofits only -
MSP2266
Plasmid#70705PurposeBacterial expression plasmid for SaCas9 & sgRNA targeted to site 2: T7-humanSaCas9-NLS-3xFLAG-T7-Sa-sgRNA(84) #2DepositorInsertsmammalian codon-optimized Staphylococcus aureus Cas9
SaCas9 sgRNA (+84)
UseCRISPRTagsNLS-3xFLAGExpressionBacterialPromoterT7Available SinceDec. 4, 2015AvailabilityAcademic Institutions and Nonprofits only -
pTX208
Plasmid#89268PurposeExpress STU Cas9 with Maize Ubiquitin1 promoter in rice targeting OsYSA gene, OsYSA-gRNA01 and OsYSA-gRNA02DepositorInsertOsYSA-gRNA01 and OsYSA-gRNA02
UseCRISPRTagsSV40 NLSExpressionPlantPromoterMaize Ubiquitin1 promoterAvailable SinceMay 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
gRNA_tdtomato_reporter_1_ST1_2x_binding
Plasmid#79368PurposeAssays activity of transcriptional activators fused to ST1 Cas9DepositorInserttdtomato
UseCRISPRExpressionMammalianAvailable SinceMay 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1kh
Plasmid#160297PurposeYeast CRISPR plasmid targeting the kanMX and hphMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceSept. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMKR07
Plasmid#240097PurposeA CRISPR‑Cas9 system for knock‑out and knock‑in of high molecular weight DNA enables module‑swapping of the pikromycin synthase in its native hostDepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyExpressionBacterialPromoterermE* promoterAvailable SinceJuly 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1nh
Plasmid#160299PurposeYeast CRISPR plasmid targeting the natMX and hphMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1kn
Plasmid#160298PurposeYeast CRISPR plasmid targeting the kanMX and natMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCJ1023
Plasmid#228763PurposePlasmid expressing Cas9 and gRNAs for mouse Ift88 and Pkd2. Use for disruption of mouse Ift88 and Pkd2 in cultured cells.DepositorUseCRISPRTags3XFLAG and GFPExpressionMammalianPromoterhuman U6Available SinceDec. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCPH2A.Z-GS3
Plasmid#204758PurposeExpression of Cas9 and human H2A.ZDepositorInsertH2AZ1 (H2AZ1 Human)
ExpressionMammalianAvailable SinceJune 13, 2024AvailabilityAcademic Institutions and Nonprofits only