We narrowed to 4,691 results for: POR C
-
Plasmid#185653PurposeNDUFV2 Complex I sub-unit with C-terminus mVenus tagDepositorAvailable SinceAug. 10, 2022AvailabilityAcademic Institutions and Nonprofits only
-
pEGFP-NDUFS6-mVenus
Plasmid#185806PurposeNDUFS6 Complex I sub-unit with C-terminus mVenus tagDepositorAvailable SinceOct. 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-NDUFA7-mVenus
Plasmid#185647PurposeNDUFA7 Complex I sub-unit with C-terminus mVenus tagDepositorAvailable SinceOct. 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGAPTrap-eGFP-IRESMuro
Plasmid#82504PurposeVector targeting the eGFP gene to the GAPDH locus of human cells. eGFP is expressed from a 2A sequence at the C terminus of GAPDH. Puromycin resistance is encoded by the Muro gene.DepositorInserteGFP-IRESMuro
UseSynthetic BiologyTagsExpressionMammalianMutationPromoterAvailable SinceSept. 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
pGAPTrap-Luc2-IRESMeo
Plasmid#82509PurposeVector targeting the Firefly Luciferase (Luc2) gene to the GAPDH locus of human cells. It is expressed from a 2A sequence at the C terminus of GAPDH. Puromycin resistance is encoded by the Meo gene.DepositorInsertLuc2-IRESMeo
UseSynthetic BiologyTagsExpressionMammalianMutationPromoterAvailable SinceSept. 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
pGAPTrap-LacZ-IRESMuro
Plasmid#82507PurposeVector targeting the LacZ gene to the GAPDH locus of human cells. LacZ is expressed from a 2A sequence at the C terminus of GAPDH. Puromycin resistance is encoded by the Muro gene.DepositorInsertLacZ-IRESMuro
UseSynthetic BiologyTagsExpressionMammalianMutationPromoterAvailable SinceSept. 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-NDUFA10-mVenus
Plasmid#185648PurposeNDUFA10 Complex I sub-unit with C-terminus mVenus tagDepositorAvailable SinceNov. 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-NDUFB6-mVenus
Plasmid#185652PurposeNDUFB6 Complex I sub-unit with C-terminus mVenus tagDepositorAvailable SinceOct. 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-NDUFS3-mVenus
Plasmid#185649PurposeNDUFS3 Complex I sub-unit with C-terminus mVenus tagDepositorAvailable SinceOct. 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-NDUFA2-mVenus
Plasmid#185645PurposeNDUFA2 Complex I sub-unit with C-terminus mVenus tagDepositorAvailable SinceJuly 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti-NDUFA10-FKBP-HA
Plasmid#185810PurposeNDUFA10 subunit of Complex I fused with C-terminal FKBP and HA epitopeDepositorInsertNDUFA10 (NDUFA10 Human)
UseLentiviralTagsFKBP and HAExpressionMammalianMutationPromoterCMVAvailable SinceJuly 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGAPTrap-Clover-Muro
Plasmid#82334PurposeVector targeting the Clover gene to the GAPDH locus of human cells. Clover is expressed from a 2A sequence at the C terminus of GAPDH. Puromycin resistance is encoded by the Muro gene.DepositorInsertClover-T2AMuro
UseSynthetic BiologyTagsExpressionMammalianMutationPromoterAvailable SinceOct. 7, 2016AvailabilityAcademic Institutions and Nonprofits only -
pGAPTrap-eGFP-IRESMeo
Plasmid#82502PurposeVector targeting the eGFP gene to the GAPDH locus of human cells. eGFP is expressed from a 2A sequence at the C terminus of GAPDH. G418 resistance is encoded by the Meo gene.DepositorInserteGFP-IRESMeo
UseSynthetic BiologyTagsExpressionMammalianMutationPromoterAvailable SinceSept. 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn-SomaGCaMP6f1
Plasmid#158755PurposeCell body-targeted GCaMP6f under synapsin promoter: GCaMP6f followed by a linker, the tail region of AnkyrinG, and an ER export motif (GCaMP6f-27-AnkTail-motif-ER2). Not as bright as SomaGCaMP6f2.DepositorInsertSomaGCaMP6f1
UseAAVTagsExpressionMammalianMutationPromotersynapsin promoterAvailable SinceSept. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-FGFR1c-V5/HIS
Plasmid#201106Purposeexpression of human FGFR1 receptor tyrosine kinase in mammalian cellsDepositorInserthuman FGFR1 receptor tyrosine kinase, variant c, full length, wildtype (FGFR1 Human)
UseTagsV5/HisExpressionMammalianMutationPromoterCMVAvailable SinceJune 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
TRE-TDP-43ΔNLS-mClover3
Plasmid#214916Purposeinducible expression of TDP-43 harboring mutant NLS and C-terminal mClover3. Expression yields cytosolic diffuse TDP-43DepositorInsertTDP-43ΔNLS (TARDBP Human)
UseLentiviralTagsmClover3ExpressionMutationmutant NLS GCAGCAGCAATGGATGAGACAGATGCTTCATCAGCAGT…PromoterAvailable SinceMay 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
VARP GFP-pLXIN
Plasmid#62950Purposefull length human VARP with C-terminal EGFP tag cloned into pLXINDepositorInsertVARP (ANKRD27 Human)
UseRetroviralTagsEGFPExpressionMammalianMutationsilent mutations of amino acids 422-428 to produc…PromoterLTRAvailable SinceMay 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
B9-COMP-blac-flag-his
Plasmid#111020PurposeExpresses pentamerised full-length protein ectodomain with no N-linked glycans in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag, COMP pentamerisation domain, flag- and 6xHis tags.DepositorInsert6-cysteine protein (B9) (PF3D7_0317100 )
UseTagsExogenous signal peptide of mouse origin and rat …ExpressionMammalianMutationAll NXT/S sites mutated to NXA, where X is any am…PromoterCMVAvailable SinceOct. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
PF3D7_1350600-COMP-blac-flag-his
Plasmid#110968PurposeExpresses pentamerised full-length protein ectodomain with no N-linked glycans in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag, COMP pentamerisation domain, flag- and 6xHis tags.DepositorInsertPF3D7_1350600 (PF3D7_1350600 )
UseTagsExogenous signal peptide of mouse origin and rat …ExpressionMammalianMutationAll NXT/S sites mutated to NXA, where X is any am…PromoterCMVAvailable SinceOct. 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
GPR180-COMP-blac-flag-his
Plasmid#110955PurposeExpresses pentamerised full-length protein ectodomain with no N-linked glycans in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag, COMP pentamerisation domain, flag- and 6xHis tags.DepositorInsertPF3D7_1213500 (PF3D7_1213500 )
UseTagsExogenous signal peptide of mouse origin and rat …ExpressionMammalianMutationAll NXT/S sites mutated to NXA, where X is any am…PromoterCMVAvailable SinceSept. 28, 2018AvailabilityAcademic Institutions and Nonprofits only