We narrowed to 5,484 results for: crispr cas9 grna plasmid
-
Plasmid#113791PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor TFAP2BDepositorAvailable SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only
-
pZNF423.1.0-gDNA
Plasmid#113790PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor ZNF423DepositorAvailable SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pREST.1.0-gDNA
Plasmid#113774PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor RESTDepositorAvailable SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pZNF462.1.0-gDNA
Plasmid#112476PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor ZNF462DepositorAvailable SinceDec. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTBPL1.1.0-gDNA
Plasmid#112412PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor TBPL1DepositorAvailable SinceDec. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSMAD3.1.0-gDNA
Plasmid#112407PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor SMAD3DepositorAvailable SinceDec. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pYZ033
Plasmid#98404PurposeEntry vector for S. pombe CRISPR-Cas9 system. The gRNA can be integrated easily through Gibson Assembly with the plasmid backbone digested by Not1DepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyAvailable SinceFeb. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
-
PX458_HHEX_1
Plasmid#72354PurposeEncodes gRNA for 3' target of human HHEX along with Cas9 with 2A GFPDepositorInsertHHEX (HHEX Human)
UseCRISPRAvailable SinceFeb. 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
PX458_HHEX_2
Plasmid#72355PurposeEncodes gRNA for 3' target of human HHEX along with Cas9 with 2A GFPDepositorInsertHHEX (HHEX Human)
UseCRISPRAvailable SinceFeb. 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCBC-DT1T2
Plasmid#50590PurposeCRISPR/Cas based plant genome editing and gene regulation; used as template for making expression cassette with multiple gRNA target sitesDepositorInsertT1, U626t plus, U629p, T2
UseCRISPR; Pcr templateExpressionPlantAvailable SinceDec. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Hbb
Plasmid#99693PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Hbb promoter, vector allows for activation of mouse Hbb, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Hbb (gRNA: GGGGTAAGGGGAGCAAGGTC) (Hbb Mouse, Synthetic)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceMay 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pNR2F1.1.0-gDNA
Plasmid#112484PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor NR2F1DepositorAvailable SinceDec. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pFOXA3.1.0-gDNA
Plasmid#112417PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor FOXA3DepositorAvailable SinceDec. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pELF4.1.0-gDNA
Plasmid#112467PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor ELF4DepositorAvailable SinceDec. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pRGEB32
Plasmid#63142PurposeExpress sgRNA/PTG with rice snoRNA U3 promoter and Cas9 with rice ubiquitin promoter for Agrobacterium-mediated transformation.DepositorTypeEmpty backboneUseCRISPRExpressionPlantPromoterRice snoRNA U3 promoter for gRNA/PTG expression a…Available SinceApril 3, 2015AvailabilityAcademic Institutions and Nonprofits only -
pEasyG3_mic
Plasmid#184920PurposeTemplate to generate via PCR two gRNAs for expression in S. cerevisiae. The PCR product from pEasyG3_mic recombines in vivo with a PCR product from pEasyG3_zeo/nat/hph.DepositorInsertgRNA scaffold
UseCRISPRExpressionBacterialAvailable SinceOct. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEasyG2_hph
Plasmid#184915PurposeTemplate to generate via PCR two gRNAs for expression in S. cerevisiae. The PCR product from pEasyG2_hph recombines in vivo with a PCR product from pEasyG2_mic.DepositorInsertgRNA scaffold
UseCRISPRExpressionBacterialAvailable SinceOct. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEasyG2_mic
Plasmid#184916PurposeTemplate to generate via PCR two gRNAs for expression in S. cerevisiae. The PCR product from pEasyG2_mic recombines in vivo with a PCR product from pEasyG2_zeo/nat/hph.DepositorInsertgRNA scaffold
UseCRISPRExpressionBacterialAvailable SinceOct. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEasyG2_zeo
Plasmid#184913PurposeTemplate to generate via PCR two gRNAs for expression in S. cerevisiae. The PCR product from pEasyG2_zeo recombines in vivo with a PCR product from pEasyG2_mic.DepositorInsertgRNA scaffold
UseCRISPRExpressionBacterialAvailable SinceDec. 13, 2022AvailabilityAcademic Institutions and Nonprofits only