We narrowed to 11,766 results for: nsf
-
Plasmid#67523PurposeThis is an envelope gene encoding plasmid to make retrogradely lentiviral vector. You can make type B envelope coating virus particle with HiRet by using this plasmid.DepositorInsertFusion Glycoprotein type B
UseLentiviralTagsFusion protein of Vesicular stomatitis Indiana vi…PromoterCAGGSAvailable SinceJuly 31, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDN-D2irTN6kwh
Plasmid#44724DepositorInsertspCMV-D2i promoter
htetR::NLS
UseSynthetic Biology; Expression regulator/reporter;…TagsRabbit β-globin intron II and WPREExpressionMammalianMutationInitiator motif (Inr) displaced relative to pCMV-…PromoterpCMV-D2iAvailable SinceApril 23, 2013AvailabilityAcademic Institutions and Nonprofits only -
pAAV-syn-FLEX-axon-jYCaMP1s
Plasmid#135421PurposeAxon-targeted yellow protein calcium sensor expressed under human Synapsin1 promoter, Cre mediated flip-excision switch, for AAV production or direct transfection, slow variantDepositorHas ServiceAAV1InsertjYCaMP1s
UseAAVTagsGAP43 axon targeting sequenceExpressionMammalianPromoterhSynAvailable SinceJan. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDam-Myc-HP1
Plasmid#59221Purposeexpresses Dam-myc-HP1DepositorInsertHP1 (Su(var)205 Fly)
UseDamidTagsDam and mycExpressionInsectPromoterDrosophila heat shock promoterAvailable SinceMay 3, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCCL-PGK-SPdCas9-BFP-DNMT3A(E752A)
Plasmid#71213PurposedCas9 fused to BFP and the human DNMT3A catalytically inactive domainDepositorInsertdSpCas9-BFP-DNMT3A(E752A), DNMT3A catalytic domain with inactivation mutation E752A
TagsdSpCas9-BFP-DNMT3A(E752A)ExpressionMammalianAvailable SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJHG003
Plasmid#126454PurposeExpresses Cas9-XTEN-dTdT in mammalian cells.DepositorInsertCas9-XTEN-dTdT (DNTT Streptococcus pyogenes, Human)
ExpressionMammalianMutationAdded D343E and D345E to inactivate TdT.PromoterCMVAvailable SinceJune 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSB65 - pL0_tGFP-I (CDS1)
Plasmid#123182PurposeGolden Gate (MoClo; CDS1) compatible turbo GFP gene from P. plumata with an intron for transient and stable expression in plants (moved to a CDS1 position from pICSL50016; Engler et al., 2014)DepositorInsertturboGFP codon-optimised for plants (P. plumata) with intron, U5 small nuclear ribonucleoprotein component (A. thaliana)
UsePart for plant expressionExpressionPlantMutationNo BpiI and BsaI sites; codon-optimised for plantsAvailable SinceMay 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBiex1-SYNAC
Plasmid#82710PurposeSynthetic soluble adenylyl cyclase FRET sensor and cAMP generatorDepositorTagsFLAG, mCerulean, and mCitrineExpressionBacterial and InsectPromoterT7Available SinceNov. 3, 2016AvailabilityAcademic Institutions and Nonprofits only -
pNIA-CEN-mVenus-FLAG-LANS1-Set2
Plasmid#122003PurposemVenus-FLAG-LANS-Set2: mVenus- and FLAG-tagged LANS1-Set2 for light control of Set2 localization in yeastDepositorInsertmVenus-FLAG-LANS1-Set2 (SET2 Budding Yeast)
UseSynthetic BiologyTagsmVenus-FLAGExpressionYeastMutationSet2 point mutations K538G, K539S, R549G, K550S, …PromoterADH1Available SinceJune 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCMV CHMP2B-L4D F5D-3XHA
Plasmid#232003PurposeExpression of a CHMP2B membrane binding mutant (L4D F5D) with a 3xHA tag.DepositorAvailable SinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEF1a FLAG-CHMP2B-d55-96
Plasmid#232013PurposeExpression of FLAG-tagged CHMP2B with the second alpha helix deleted.DepositorAvailable SinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSPcas9(BB)-2A-Puro V2.0 sgCHMP2B-2 aauucccaaaugaagauggc
Plasmid#231998PurposeExpression of an sgRNA targeting CHMP2B, Cas9, and a PuroR markerDepositorAvailable SinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1α-DIO-cOpn5-T2A-EGFP
Plasmid#237858PurposeThe transfer plasmid for packaging AAV expressing Cre-dependent chicken OPN5 was constructed by inserting the OPN5 coding sequence into the multiple cloning site under the control of EF1α promoterDepositorAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1α-DIO-cOpn5-T2A-mcherry
Plasmid#238009PurposeThe transfer plasmid for packaging AAV expressing Cre-dependent chicken OPN5 was constructed by inserting the OPN5 coding sequence into the multiple cloning site under the control of EF1α promoterDepositorAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAV-CMV-scFVDnmt3A_bGHpA
Plasmid#177349PurposeAAV expression of scFV-fused catalytic domain of Dnmt3a for targeted DNA methylation editingDepositorInsertcatalytic domain of DNA Methyltransferase 3 Alpha (Dnmt3a Mouse)
UseAAVTagsmyc and scFVExpressionMammalianMutation598–908 aa of mouse Dnmt3aPromoterCMVAvailable SinceSept. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKG-GW1-hCIT K42E
Plasmid#203168PurposeYeast expression vector for human DHDDS K42EDepositorAvailable SinceJan. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pT22UbhaEng2aE4PCh(#271)
Plasmid#184085Purposecyclofen-inducible fish Eng2a (wt) activation in zebrafish permanent transgenicDepositorInsert3HA-ZfEng2a-ERT2-P2A-mCherry
UseZebrafish transgenesis (blue eyes)Tags3xHAMutationERT2: G400V, M543A, L544A, deleted 1-281;PromoterZf-UbiAvailable SinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT22UbhaEng2bE4PCh(#272)
Plasmid#184086Purposecyclofen-inducible fish Eng2b (wt) activation in zebrafish permanent transgenicDepositorInsert3HA-ZfEng2b-ERT2-P2A-mCherry
UseZebrafish transgenesis (blue eyes)Tags3xHAMutationERT2: G400V, M543A, L544A, deleted 1-281;PromoterZf-UbiAvailable SinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT22gCfpUbm5En2E4PCh(#251)
Plasmid#184083Purposecyclofen-inducible chicken EN2 (wt) activation in zebrafish permanent transgenicDepositorInsert5myc-chkEn2-ERT2-P2A-mCherry
UseZebrafish transgenesis (blue eyes)Tags5xMycMutationERT2: G400V, M543A, L544A, deleted 1-281;PromoterZf-UbiAvailable SinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT22Ubm5Eng2bE4PCh(#284)
Plasmid#184088Purposecyclofen-inducible fish Eng2b (wt) activation in zebrafish permanent transgenicDepositorInsert5myc-ZfEng2b-ERT2-P2A-mCherry
UseZebrafish transgenesis (blue eyes)Tags5xMycMutationERT2: G400V, M543A, L544A, deleted 1-281;PromoterZf-UbiAvailable SinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only