We narrowed to 35,571 results for: CaS
-
Plasmid#194926PurposeInducible Expression of N-Terminal 3X Flag Mouse C325A Caspase-9 Minus Large Subunit Region Val 177 to Arg 263DepositorInsertN-Terminal 3X Flag Mouse C325A Caspase-9 Minus Sequence Encoding Val 177 to Arg 263 (Casp9 Mouse)
Tags3X FlagExpressionMammalianMutationChanged Cysteine 325 to Alanine to Eliminate Prot…PromoterCMVAvailable SinceFeb. 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX335_U6-Chimeric_BB-CBh-hSpCas9n(D10A)_SOX17_Ex2_KI
Plasmid#195502PurposeCas9 nickase expression vector bearing a sgRNA targeting Exon 2 of human SOX17DepositorAvailable SinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-DR30(sapI)-CMV-intron-hfCas13d-pA
Plasmid#195865PurposeTo express hfCas13dDepositorInserthigh fidelity (hf) version of CasRx (hfCas13d)
UseAAVMutationYes: GTGGAATACATTACCAACGTGGTGTACGTGPromoterCMVAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLV hUbC-Cas9-P2A-Puro_ST-sgRNA
Plasmid#188705PurposeLentivirus transfer plasmid encoding Cas9, puromycin resistance, and 4 sgRNAs targeting human safe targeting lociDepositorInsertST sgRNAs
UseLentiviralExpressionMammalianPromoterhUbCAvailable SinceDec. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-IRES-GFP-mouse-Caspase-1-H340D
Plasmid#183362PurposeStable expression of mammalian inflammatory caspase gene in mammalian cells by retroviral transductionDepositorAvailable SinceJuly 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-IRES-GFP-Mouse-caspase-1/11a
Plasmid#183391PurposeExpression of mammalian inflammatory caspase gene in mammalian cells by retroviral transductionDepositorInsertCARD domain of mouse caspase-1 fused to catalytic domain of mouse caspase-11 (Casp1 Mouse, Synthetic)
UseRetroviralTagsMycPromoterMESVAvailable SinceJuly 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pVH333-1-Tier1-PhCMV-dCas9-3xNLS-VP64
Plasmid#169597PurposeTier-1 vector encoding PhCMV-driven dCas9-3xNLS-VP64 expression (PhCMV-dCas9-3xNLS-VP64-pA).DepositorInsertdead S.pyogenes Cas9 - VP64 fusion
ExpressionMammalianPromoterPhCMVAvailable SinceJuly 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pVH321-2-Tier1-PhCMV-NLS-dCas9-3xNLS
Plasmid#169596PurposeTier-1 vector encoding PhCMV-driven NLS-dCas9-3xNLS expression (PhCMV-NLS-dCas9-3xNLS-pA).DepositorInsertdead S.pyogenes Cas9
ExpressionMammalianPromoterPhCMVAvailable SinceJune 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-IRES-GFP-polar-bear-Caspase-1/4b
Plasmid#183370PurposeStable expression of mammalian inflammatory caspase gene in mammalian cells by retroviral transductionDepositorInsertCaspase-1/4b
UseRetroviralTagsMycPromoterMESVAvailable SinceMay 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-IRES-GFP-harbour-seal-Caspase-1/4b
Plasmid#183368PurposeStable expression of mammalian inflammatory caspase gene in mammalian cells by retroviral transductionDepositorInsertCaspase-1/4b
UseRetroviralTagsMycPromoterMESVAvailable SinceMay 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-IRES-GFP-human-Caspase-1-H340D
Plasmid#183360PurposeStable expression of mammalian inflammatory caspase gene in mammalian cells by retroviral transductionDepositorAvailable SinceMay 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-IRES-GFP-Mouse-caspase-1/11b
Plasmid#183392PurposeExpression of mammalian inflammatory caspase gene in mammalian cells by retroviral transductionDepositorInsertCARD domain of mouse caspase-1 fused to mouse caspase-11 (Casp1 Mouse, Synthetic)
UseRetroviralTagsMycPromoterMESVAvailable SinceMay 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJCC_163 SpCas9 K233A/K234A/K253A/K263A
Plasmid#179527PurposeFor bacterial expression of SpCas9 K233A/K234A/K253A/K263A (helix-rolling basic patch mutant) with an N-terminal His-MBP tagDepositorInsertSpCas9 K233A/K234A/K253A/K263A
Tags10X His, TEV protease cleavage site, and maltose-…ExpressionBacterialMutationchanged lysines 233, 234, 253, and 263 to alanineAvailable SinceApril 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti KO CLDN1 2xgRNA - spCas9 iRFP670 puro
Plasmid#166133PurposeThis plasmid allows efficient KO of the cldn1 gene, while expressing the far red fluorescent protein iRFP670 and puromycin resistanceDepositorInserthU6-gRNA and hH1-gRNA targeting cldn1 gene
UseCRISPR and LentiviralTagsiRFP670ExpressionMammalianAvailable SinceApril 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
loxP-T2A-Myr-Casp8-ERT2-rox
Plasmid#182362PurposeShuttle vector for T2A-Myr-Casp8-ERT2DepositorInsertloxP-T2A-Myr-Casp8-ERT2-rox
UseCre/Lox and Mouse Targeting; Dre / roxExpressionMammalianAvailable SinceMarch 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
loxP-T2A-Myr-DeadCasp8-ERT2-rox
Plasmid#182361PurposeShuttle vector for T2A-Myr-DeadCasp8-ERT2DepositorInsertloxP-T2A-Myr-DeadCasp8-ERT2-rox
UseCre/Lox and Mouse Targeting; Dre / roxExpressionMammalianAvailable SinceMarch 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
1098E=TI-pgSIT[tra,bTub,Hasp70Bb-Cas9]
Plasmid#149427PurposeThe attB plasmid with the mini-white harboring two U6.3-gRNAs targeting Dmel tra and bTub genes, and Hsp70Bb-Cas9-T2A-eGFP-p10.DepositorInsertsU6.3-gRNAs[TraB, bTub]
Hsp70Bb-Cas9-T2A-eGFP-p10
UseCRISPRTagseGFPExpressionInsectAvailable SinceMarch 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
cTRE-LSL-GFP-IRES-Cas9-sgPtenX1.1
Plasmid#135669PurposeIntroduce Dox/Cre-inducible (TRE promoter followed by lox-stop-lox) Cas9 cDNA plus Pten-targeting sgRNA into (ES) cells by recombination-mediated cassette exchangeDepositorInsertsgPten
UseMouse TargetingAvailable SinceJan. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
CMV+ (mScarlet-I) plasmid with onboard mCitrine cassette
Plasmid#169743PurposeCMV+ circuit plasmid that encodes mScarlet-I to report the circuit output levels. This plasmid also encodes a separate mCitrine expression cassette to monitor plasmid dosage.DepositorInsertmScarlet-I
UseSynthetic BiologyExpressionMammalianPromoterpCMV-tetO2Available SinceOct. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
p23-NES-RanCas13b-msfGFP-NES-Flag
Plasmid#165073Purposeoverexpression of RanCas13b in human cellsDepositorInsertRanCas13b
UseLentiviralExpressionMammalianAvailable SinceSept. 30, 2021AvailabilityAcademic Institutions and Nonprofits only