We narrowed to 27,024 results for: CAT;
-
Plasmid#202145PurposeLevel 0 plasmid containing a mRFP1 fluorescent protein with CD overhangs used to build a level 1 construct.DepositorInsertmRFP1 gene
UseSynthetic BiologyMutationNoneAvailable SinceAug. 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
pL0_CD-eYGFP-uv
Plasmid#202144PurposeLevel 0 plasmid containing an eYGFP-uv fluorescent protein with CD overhangs used to build a level 1 construct.DepositorInserteYGFP-uv gene
UseSynthetic BiologyMutationNoneAvailable SinceAug. 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
pL0_CD-mcherry
Plasmid#202143PurposeLevel 0 plasmid containing a mCherry fluorescent protein with CD overhangs used to build a level 1 construct.DepositorInsertmCherry gene
UseSynthetic BiologyMutationNoneAvailable SinceAug. 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
pL0_CD-eCFP
Plasmid#202142PurposeLevel 0 plasmid containing an eCFP fluorescent protein with CD overhangs used to build a level 1 construct.DepositorInserteCFP gene
UseSynthetic BiologyMutationNoneAvailable SinceAug. 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
pL0_CD-roGFP
Plasmid#202140PurposeLevel 0 plasmid containing a roGFP fluorescent protein with CD overhangs used to build a level 1 construct.DepositorInsertroGFP gene
UseSynthetic BiologyMutationNoneAvailable SinceAug. 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
pL0_CD-eYFP
Plasmid#202139PurposeLevel 0 plasmid containing an eYFP fluorescent protein with CD overhangs used to build a level 1 construct.DepositorInserteYFP gene
UseSynthetic BiologyMutationNoneAvailable SinceAug. 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
pL0_AF-spacer
Plasmid#202130PurposeLevel 0 plasmid containing a small non-coding spacer sequence with AF overhangs used to build level 1 constructs.DepositorInsertSpacer
UseSynthetic BiologyMutationNoneAvailable SinceAug. 25, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
FKBP-TalinRod-mEmerald
Plasmid#202382PurposeFKBP12-Talin(434-2541)-mEmeraldDepositorInsertFKBP12-Talin(434-2541)-mEmerald
ExpressionMammalianAvailable SinceAug. 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
FKBP-TalinC11-mEmerald
Plasmid#202381PurposeFKBP12-Talin(1974-2541)-mEmeraldDepositorInsertFKBP12-Talin(1974-2541)-mEmerald
ExpressionMammalianAvailable SinceAug. 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
mApple-TalinN12-FB(wt)
Plasmid#202385PurposemApple-Talin(1-2299)-FRBDepositorInsertmApple-Talin(1-2299)-FRB
ExpressionMammalianAvailable SinceAug. 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
mApple-TalinN3-FRB(wt)
Plasmid#202384PurposemApple-Talin(1-911)-FRBDepositorInsertmApple-Talin(1-911)-FRB
ExpressionMammalianAvailable SinceAug. 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
mApple-TalinN10-FRB
Plasmid#202380PurposemApple-Talin(1-1973)-FRBDepositorInsertmApple-Talin(1-1973)-FRB
ExpressionMammalianAvailable SinceAug. 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHiUGE Myc-epitope donor ORF2
Plasmid#200376PurposeTagging endogenously expressed proteins with Myc epitope, C-terminalDepositorInsertMyc epitope
ExpressionMammalianMutationNAAvailable SinceJuly 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
H5_fold-0_Elsa
Plasmid#201825PurposeExpresses H5_fold-0_Elsa in bacterial cellsDepositorInsertH5_fold-0_Elsa
Tags6xHis, TEV cleavage siteExpressionBacterialAvailable SinceJune 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAG306-pTet07-synYFP[TTG/AGA]-4xArg[CGA]-nLuc
Plasmid#199759PurposeElongation reporter construct to quantify elongation duration of 4_CGA stallingDepositorInsertsynYFP[TTG/AGA]-4xArg[CGA]-nLuc
ExpressionYeastPromoterTetO7Available SinceMay 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
OA-1067L
Plasmid#200253PurposepBac-U6-gRNA(doublesex+Intersex+bTublin)-3xp3-tdTomatoDepositorInsert6 gRNAs targeting Doublesex, Intersex, bTublin
ExpressionInsectAvailable SinceMay 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAG306-pTet07-synYFP[TTG/AGA]-6xArg[CGA]-nLuc
Plasmid#199760PurposeElongation reporter construct to quantify elongation duration of 6_CGA stallingDepositorInsertsynYFP[TTG/AGA]-6xArg[CGA]-nLuc
ExpressionYeastPromoterTetO7Available SinceMay 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAG306-pTet07-synYFP[TTG/AGA]-6xArg[AGA]-nLuc
Plasmid#199761PurposeElongation reporter construct to quantify elongation duration of 6_AGA stallingDepositorInsertsynYFP[TTG/AGA]-6xArg[AGA]-cLuc
ExpressionYeastPromoterTetO7Available SinceMay 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCA28-pMa-PspCas13b crRNA-TS1
Plasmid#199459PurposeU6-driven crRNA targeting TS1 sequence (CCTCCTCGGAGAGCATCGGTGC )DepositorInsertTS1 crRNA
UseCRISPRPromotermouse U6Available SinceMay 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCA17-CRISPR-Tag (11XTS1) for dSpCas9
Plasmid#199448PurposeCRISPR-Tag sequence that can be efficiently bound by dSpCas9DepositorInsertCRISPR-Tag
UseCRISPRAvailable SinceMay 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
SP_H6_Halo_L172Q_KDEL_pBABEpu
Plasmid#183690PurposeRetroviral expression of ER-targeted metastable Halotag/folding sensor (ER HaloL172Q)DepositorInsertER Halo(L172Q)
UseRetroviralMutationL72Q in HalotagAvailable SinceApril 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
SP_H6_Halo_M21K_F86L_KDEL_pBABEpu
Plasmid#183691PurposeRetroviral expression of ER-targeted metastable Halotag/folding sensor (ER HaloM21K_F86L)DepositorInsertER Halo(M21K_F86L)
UseRetroviralMutationM21K_F86L in HalotagAvailable SinceApril 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pET30_Halotag_K73T_Jdomain
Plasmid#183693PurposeBacterial expression of ER-targeted metastable Halotag/folding sensor (HaloK73T) fused with J domainDepositorInsertER Halo(K73T)-J domain
ExpressionBacterialMutationK73T in HalotagAvailable SinceApril 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEYFP-N1-HsSmg6-mut-siRNAres_I
Plasmid#146588PurposeMammalian Expression of HsSmg6-mut-siRNAresDepositorInsertHsSmg6-mut-siRNAres (SMG6 Human)
ExpressionMammalianMutationtwo silent mutations T594C, A699G and two non sil…Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pORE303N_CEN12Fuzzy3MYB
Plasmid#194440PurposeCRISPR, Cas9 driven by double 35S, nptII for plant selection, knockout: CEN12 and Fuzzy3MYBDepositorInsertgRNA array targeting CEN1, Fuzzy3MYB
UseCRISPRExpressionPlantPromoterMtU6Available SinceMarch 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
HySp5-310
Plasmid#192995PurposePlasmid that encodes for Hydra Sp5, lacking the SP boxDepositorInsertHydra Sp5
TagsHAExpressionMammalianMutationno SP boxAvailable SinceFeb. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pORE303N_CEN1
Plasmid#194439PurposeCRISPR, Cas9 driven by double 35S, nptII for plant selection, knockout CEN1DepositorInsertgRNA targeting CEN1
UseCRISPRExpressionPlantPromoterMtU6Available SinceJan. 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
OA-1093B
Plasmid#194003PurposepBac-U6-crCHIKV-array-UTR-3xp3-tdTomatoDepositorInsert4 gRNAs targeting CHIKV
ExpressionInsectAvailable SinceJan. 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
OA-1085F
Plasmid#191375PurposepBac-U6-crYellow-array-UTR-3xp3-tdTomatoDepositorInsert4 gRNAs targeting yellow
ExpressionInsectAvailable SinceJan. 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCRISPR3_BC2
Plasmid#191857PurposeBarcoded plasmid with BsaI sites to clone sgRNA. The 6-nucleotide barcode (sequence: ATCATG) near the sgRNA insert region enables demultiplexing replicates while sequencing the sgRNA region.DepositorTypeEmpty backboneUseCRISPRAvailable SinceJan. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pXPR_003_sgTFAP4 guide 2
Plasmid#193587PurposeTFAP4 knockoutDepositorInsertsgTFAP4 guide 2 (TFAP4 Human)
UseLentiviralAvailable SinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCRISPR3_BC3
Plasmid#191858PurposeBarcoded plasmid with BsaI sites to clone sgRNA. The 6-nucleotide barcode (sequence: GCATGG) near the sgRNA insert region enables demultiplexing replicates while sequencing the sgRNA region.DepositorTypeEmpty backboneUseCRISPRAvailable SinceDec. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGEM-T-Easy-HySp5-557
Plasmid#193000PurposePlasmid to generate an ISH probe for Hydra Sp5DepositorInsertHydra Sp5
UseCloning vectorAvailable SinceDec. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
ZfSp5a-377
Plasmid#192997PurposePlasmid that encodes for Zebrafish Sp5DepositorInsertZebrafish Sp5
TagsHAExpressionMammalianAvailable SinceDec. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
HySp5-227
Plasmid#192996PurposePlasmid that encodes for Hydra Sp5, lacking the SP box and DNA binding domainDepositorInsertHydra Sp5
TagsHAExpressionMammalianMutationno SP box and DNA binding domainAvailable SinceDec. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
HySp5:Luc
Plasmid#192985PurposePlasmid to test the Hydra Sp5 promoter activityDepositorInsertHydra Sp5 promoter
ExpressionMammalianAvailable SinceDec. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
ZfSp5l1
Plasmid#192999PurposePlasmid that encodes for Zebrafish Sp5-likeDepositorInsertZebrafish Sp5-like
TagsHAExpressionMammalianAvailable SinceDec. 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
HySp5-337
Plasmid#192994PurposePlasmid that encodes for Hydra Sp5, lacking the DNA binding domainDepositorInsertHydra Sp5
TagsHAExpressionMammalianMutationno DNA binding domainAvailable SinceDec. 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
ZfWnt3:Luc
Plasmid#192992PurposePlasmid to test the Zebrafish Wnt3 promoter activityDepositorInsertZebrafish Wnt3 promoter
ExpressionMammalianAvailable SinceDec. 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
Gly-tRNA-gRNA scaffold for library 2
Plasmid#192365PurposetRNA sequence provider (for checkpoint library)DepositorInsertGly tRNA-gRNA scaffold
UseFor golden gate assemblyAvailable SinceOct. 24, 2022AvailabilityAcademic Institutions and Nonprofits only