We narrowed to 4,562 results for: TIL;
-
Plasmid#195410PurposeExpresses FLAG-HA tagged human NAP1 with S318A point mutationDepositorInsertNak associated protein 1 (AZI2 Human)
UseLentiviralTagsFLAG-HAExpressionMammalianMutationSerine 318 turned to AlanineAvailable SinceOct. 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMEXneo-TrkC-Δ6
Plasmid#190204PurposeTo express the human TrkC that has in the extracellular domain only the second IgG like domain. Still binds NT-3.DepositorInsertTrkC (NTRK3 Human)
ExpressionMammalianMutationThe extracellualr domain conatins only the signal…PromoterMoloney mouse sarcoma virus right LTRAvailable SinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLL3.7-EF-EYFP-YAP1_5SA-PolyA
Plasmid#112285PurposeFluorescently labels human YAP1-2gamma isoform (504 aa) 5SA active mutant - serines 61, 109, 127, 164 and 397 (also known as 381 in other isoforms)DepositorInsertEYFP-YAP1 (YAP1 Human)
UseLentiviralMutationHuman YAP1-2gamma with 5 Serines (61, 109, 127, 1…PromoterEF-1 alphaAvailable SinceMay 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV uN2C GFP (Ctl)
Plasmid#224355PurposeExpress GFP tagged upsteram ORF of NOTCH2NLC with a control size (12x) of GGC repeatsDepositorInsertuN2C
UseAAVTagseGFPExpressionMammalianMutationCodon-optimized for expression in human, so no pu…PromoterCMV + chimeric intyron (CAG)Available SinceOct. 7, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pYX-N-Puro-mNeon-TSC22D4
Plasmid#222671Purposeendogenously tag TSC22D4 with N-terminal mNeonDepositorAvailable SinceOct. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLL3.7-EF-EYFP-YAP1_WW-PolyA
Plasmid#112290PurposeFluorescently labels human YAP1-2gamma isoform (504 aa) WW mutant. WQDP (199-202) in the first WW domain was changed to AQDA, and the WLDP (258-261) of the second WW domain was changed to ALDADepositorInsertEYFP-YAP1 (YAP1 Human)
UseLentiviralMutationHuman YAP1-2gamma with mutations in the WW domain…PromoterEF-1 alphaAvailable SinceMay 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLL3.7-EF-EYFP-YAP1_delta5C-PolyA
Plasmid#112289PurposeFluorescently labels human YAP1-2gamma isoform (504 aa) delta5C mutant lacking the last five residues (FLTWL) in the PDZ binding domain at the N-terminus of the proteinDepositorInsertEYFP-YAP1 (YAP1 Human)
UseLentiviralMutationHuman YAP1-2gamma lacking the last 5 Amino acids …PromoterEF-1 alphaAvailable SinceMay 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLL3.7-EF-EYFP-YAP1_Y3F-PolyA
Plasmid#112288PurposeFluorescently labels human YAP1-2gamma isoform (504 aa) Y3F mutant _ tyrosines 341, 357 and 394 corresponding to tyrosines 391, 407 and 444 in this isoformDepositorInsertEYFP-YAP1 (YAP1 Human)
UseLentiviralMutation3 Tyrosines (341, 357 and 394 corresponding to ty…PromoterEF-1 alphaAvailable SinceMay 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-PARK7WT-VA
Plasmid#115182PurposeLentiviral transduction and expression of PARK7WT into any mammalian cellDepositorInsertPARK7WT (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pD649-HAsp-CD96-COMP5AP-AviTag-9xHis
Plasmid#157448PurposeMammalian expression of cell-surface protein extracellular domain fused to COMP5AP-AviTag-9xHis. Protein is secreted from cells.DepositorAvailable SinceMarch 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pD649-HAsp-CD96-Fc(DAPA)-AviTag-6xHis
Plasmid#156884PurposeMammalian expression of cell-surface protein extracellular domain fused to Fc(DAPA)-Avi-6xHis. Protein is secreted from cells.DepositorInsertCD96 (CD96 Human)
TagsFc(DAPA)-AviTag-6xHisExpressionMammalianMutationFc region of human IgG contains D265A and P329A m…PromoterCMV/SP6Available SinceJan. 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-PARK7V51G-VA
Plasmid#115183PurposeLentiviral transduction and expression of PARK7V51G into any mammalian cellDepositorInsertPARK7V51G (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationp.V51GPromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-PARK7C53A-VA
Plasmid#115184PurposeLentiviral transduction and expression of PARK7C53A into any mammalian cellDepositorInsertPARK7C53A (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationp.C53APromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-PARK7H126A-VA
Plasmid#115185PurposeLentiviral transduction and expression of PARK7H126A into any mammalian cellDepositorInsertPARK7H126A (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationp.H126APromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-PARK7E163K-VA
Plasmid#115186PurposeLentiviral transduction and expression of PARK7E163K into any mammalian cellDepositorInsertPARK7E163K (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationp.E163KPromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV uN2CpolyGly op GFP (NIID)
Plasmid#224356PurposeExpress GFP tagged upsteram ORF of NOTCH2NLC with an expansion (100x) of GGC repeats with codon optimization (NOT pure GGC repeats)DepositorInsertuN2C with a GGC repeat expansion (100x)
UseAAVTagseGFPExpressionMammalianMutationCodon-optimized for expression in human, so no pu…PromoterCMV + chimeric intron (CAG)Available SinceFeb. 5, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
Calb1-T2A-dgCre targeting vector
Plasmid#114438PurposeTarget dgCre into the endogenous mouse Calb1 locus at the stop codonDepositorInsertdgCre
UseMouse TargetingTagsDHFR domain and EGFPPromoternone; utilizes endogenous Calb1 promoter for expr…Available SinceJan. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7WT-VA
Plasmid#115187PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7WT into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7WT (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7V51G-VA
Plasmid#115188PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7V51G into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7V51G (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7C53A-VA
Plasmid#115189PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7C53A into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7C53A (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only