We narrowed to 1,259 results for: EYFP
-
Plasmid#182862PurposeHetero-tetramer expression vectorDepositorInsertmEYFP-mCherry2-mEGFP-mApple
ExpressionMammalianAvailable SinceApril 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
plex_307-EYFP-ccdB-zeo
Plasmid#201129PurposepLEX_307 plasmid with N-terminal EYFP tag and zeo markerDepositorTypeEmpty backboneTagsEYFPExpressionMammalianPromoterEF-1αAvailable SinceAug. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-TRE-DIO-eYFP-f
Plasmid#104057PurposeAn AAV genome with tet-inducible, Cre-dependent expression of the fluorescent protein eYFP with a C-terminal Hras farnesylation sequenceDepositorInsertEYFP-f
UseAAVPromoterTREAvailable SinceJune 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-eYFP-3x-miR708-5p-TS
Plasmid#117381PurposeAn AAV genome containing miRNA target sequence (TS) 708-5p to reduce expression of the fluorescent protein eYFP in neuronsDepositorInsertEYFP + 3 copies of miR708: CCCAGCTAGATTGTAAGCTCCTT
UseAAVExpressionMammalianPromoterCAGAvailable SinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
plex_307-EYFP-ccdB-blasticidin
Plasmid#201131PurposepLEX_307 plasmid with N-terminal EYFP tag and blasticidin markerDepositorTypeEmpty backboneTagsEYFPExpressionMammalianPromoterEF-1αAvailable SinceAug. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLIX403-EYFP-ccdB-G418
Plasmid#158550PurposeSet of empty Gateway Cloning compatible, inducible, lentiviral vectors with various mammalian selection markers and N-terminal fluorescent protein fusionsDepositorTypeEmpty backboneUseLentiviralTagsEYFPExpressionMammalianAvailable SinceAug. 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-eYFP-3x-miR204-5p-TS
Plasmid#117380PurposeAn AAV genome containing miRNA target sequence (TS) 204-5p to reduce expression of the fluorescent protein eYFP in astrocytesDepositorInsertEYFP + 3 copies of miR204 : AGGCATAGGATGACAAAGGGAA
UseAAVExpressionMammalianPromoterCAGAvailable SinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLenti/TO/EYFP-P2A-IDH1(HA)
Plasmid#122482PurposeA lentiviral vector (pLenti6.3/TO/DEST) expresses EYFP, P2A, and IDH1 C-terminally tagged with HADepositorInsertisocitrate dehydrogenase 1 (IDH1 Human)
UseLentiviralTagsHA and P2AExpressionMammalianPromoterCMV/TOAvailable SinceMarch 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLL3.7-EF-EYFP-YAP1_WW-PolyA
Plasmid#112290PurposeFluorescently labels human YAP1-2gamma isoform (504 aa) WW mutant. WQDP (199-202) in the first WW domain was changed to AQDA, and the WLDP (258-261) of the second WW domain was changed to ALDADepositorInsertEYFP-YAP1 (YAP1 Human)
UseLentiviralMutationHuman YAP1-2gamma with mutations in the WW domain…PromoterEF-1 alphaAvailable SinceMay 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pEYFP-Pds1Δdestruction box(383)
Plasmid#39848DepositorAvailable SinceOct. 31, 2012AvailabilityAcademic Institutions and Nonprofits only -
pJM502 ZF1x6-C EYFP in TUPV1
Plasmid#161527PurposeInducible expression of EYFP under the ZF1x6-C promoterDepositorInsertEYFP
UseSynthetic BiologyExpressionMammalianPromoterZF1x6-CAvailable SinceJan. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJM587 ZF10x6-C EYFP in TUPV2
Plasmid#161530PurposeInducible expression of EYFP under the ZF10x6-C promoterDepositorInsertEYFP
UseSynthetic BiologyExpressionMammalianPromoterZF10x6-CAvailable SinceJan. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLL3.7-EF-EYFP-YAP1_delta5C-PolyA
Plasmid#112289PurposeFluorescently labels human YAP1-2gamma isoform (504 aa) delta5C mutant lacking the last five residues (FLTWL) in the PDZ binding domain at the N-terminus of the proteinDepositorInsertEYFP-YAP1 (YAP1 Human)
UseLentiviralMutationHuman YAP1-2gamma lacking the last 5 Amino acids …PromoterEF-1 alphaAvailable SinceMay 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLL3.7-EF-EYFP-YAP1_Y3F-PolyA
Plasmid#112288PurposeFluorescently labels human YAP1-2gamma isoform (504 aa) Y3F mutant _ tyrosines 341, 357 and 394 corresponding to tyrosines 391, 407 and 444 in this isoformDepositorInsertEYFP-YAP1 (YAP1 Human)
UseLentiviralMutation3 Tyrosines (341, 357 and 394 corresponding to ty…PromoterEF-1 alphaAvailable SinceMay 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKIIa-ChRger3-TS-EYFP
Plasmid#127241PurposeHigh photocurrent, low-light sensitive channelrhodopsin (ChRger3) for optogenetic activation with systemic delivery or for low-light activation. Driven by the CamKIIa promoter.DepositorInsertChRger3-TS-EYFP
UseAAVTagsEYFP and SpyTagExpressionMammalianPromoterCamKIIaAvailable SinceSept. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pET15b/EYFP-GgVcl 1-851
Plasmid#46264DepositorInsertVcl 1-851 (VCL Chicken)
TagsEYFP and HisExpressionBacterialMutationaa 1-851 (aka Vh) head domainPromoterT7Available SinceJuly 10, 2013AvailabilityAcademic Institutions and Nonprofits only -
pJM467 TRE3GV EYFP in TU3
Plasmid#139255PurposeTRE3GV promoter and EYFP in TUPV3DepositorInsertEYFP
UseSynthetic BiologyExpressionMammalianPromoterTRE3GVAvailable SinceFeb. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pmCherry2-CD86-mEYFP(Q69K)
Plasmid#190749PurposeExpression of CD86 double tagged with mCherry2 (N-term) and mEYFP(Q69K) (C-term) in mammalian cells.DepositorAvailable SinceSept. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLIX403-EYFP-ccdB-EBFP2
Plasmid#158553PurposeSet of empty Gateway Cloning compatible, inducible, lentiviral vectors with various mammalian selection markers and N-terminal fluorescent protein fusionsDepositorTypeEmpty backboneUseLentiviralTagsEYFPExpressionMammalianAvailable SinceAug. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKIIa-ChRger1-TS-EYFP
Plasmid#127244PurposeHigh photocurrent, low-light sensitive channelrhodopsin (ChRger1) for optogenetic activation with systemic delivery or for low-light activation. Driven by the CamKIIa promoter.DepositorInsertChRger1-TS-EYFP
UseAAVTagsEYFP and SpyTagExpressionMammalianPromoterCamKIIaAvailable SinceSept. 27, 2019AvailabilityAcademic Institutions and Nonprofits only