We narrowed to 14,145 results for: TIM;
-
Plasmid#80240Purpose3rd generation lentiviral gRNA plasmid, non-targeting control gRNADepositorInsertNon-targeting control gRNA
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceAug. 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
pETDuet-1-6xHis-TEV-Nsp8
Plasmid#201022PurposeBacterial expression of codon optimized SARS-CoV-2 nsp8 tagged with an N-terminus His-tag followed by a TEV protease cleavage site.DepositorInsertnon-structural protein 8 (ORF1ab Severe acute respiratory syndrome coronavirus 2, Synthetic)
Tags6xHis-TEVExpressionBacterialMutationGene insert is codon optimized for Ecoli.PromoterT7/LacOAvailable SinceMay 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMuLE ENTR SV40-hCas9 L3-L2
Plasmid#62133PurposeMuLE (Multiple Lentiviral Expression) Entry vector containing SV40 promoter and human codon optimized Cas9 module. Compatible with MultiSite Gateway cloningDepositorInserthuman codon optimized Cas9
UseCRISPR; Mule gateway entry vectorExpressionMammalianPromoterSV40Available SinceJune 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
PLK1 gRNA (BRDN0001144743)
Plasmid#76458Purpose3rd generation lentiviral gRNA plasmid targeting human PLK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-BAP-Sox2
Plasmid#133281PurposeExpression of target proteins BAP-Sox2 in mammalian cellsDepositorInsertSox2 (SOX2 Human)
TagsBiotin Acceptor Peptide contains 7-His-tagExpressionMammalianPromoterCMVAvailable SinceJan. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
PLK1 gRNA (BRDN0001147678)
Plasmid#76460Purpose3rd generation lentiviral gRNA plasmid targeting human PLK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLNCX2-mCherry-CHMP2A-siRNAres
Plasmid#115332Purposeexpresses siRNA-resistant mCherry-CHMP2A in mammalian cellsDepositorInsertCHMP2A (CHMP2A Human)
UseRetroviralTagsmCherryExpressionMammalianMutationmutated to be resistant to siRNA knockdownPromoterCMVAvailable SinceSept. 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
FLAG-HA-FbxO10-pcDNA3.1-
Plasmid#52508Purposeexpresses human FbxO10 in mammalian cells with FLAG-HA tag at N-terminusDepositorAvailable SinceJuly 31, 2015AvailabilityAcademic Institutions and Nonprofits only -
INCTbiosyn-pAct-AtINT4
Plasmid#127530PurposePlasmid encodes A. thaliana codon optimized Integrase 4.DepositorInsertIntegrase 4 coding sequence codon optimized for A. thaliana expression.
ExpressionPlantAvailable SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
PIP5K1A gRNA (BRDN0001147757)
Plasmid#77963Purpose3rd generation lentiviral gRNA plasmid targeting human PIP5K1ADepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PIP5K1A gRNA (BRDN0001147420)
Plasmid#77964Purpose3rd generation lentiviral gRNA plasmid targeting human PIP5K1ADepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PIP5K1B gRNA (BRDN0001147624)
Plasmid#77083Purpose3rd generation lentiviral gRNA plasmid targeting human PIP5K1BDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PTK6 gRNA (BRDN0001149364)
Plasmid#76490Purpose3rd generation lentiviral gRNA plasmid targeting human PTK6DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
ADCK4 gRNA (BRDN0001145019)
Plasmid#76560Purpose3rd generation lentiviral gRNA plasmid targeting human ADCK4DepositorInsertADCK4
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pET-dHeFSpCas9-VP64-6xHis
Plasmid#92119PurposeExpression of dead/inactive increased fidelity HeFSpCas9-VP64-6xHis in bacterial cellsDepositorInsertdead/inactive HeFSpCas9-NLS-3xFLAG-VP64
UseCRISPRTags3xFLAG, 6xHis, NLS, and VP64ExpressionBacterialMutationD10A, N497A, R661A, Q695A, H840A, K848A, Q926A, K…PromoterT7Available SinceOct. 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCNL-C1_fibrillarin
Plasmid#65709PurposeExpresses CNL-fibrillarin in mammalian cellsDepositorAvailable SinceJune 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
non-targeting control gRNA (BRDN0001145269)
Plasmid#80249Purpose3rd generation lentiviral gRNA plasmid, non-targeting control gRNADepositorInsertNon-targeting control gRNA
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceAug. 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
ROCK2 gRNA (BRDN0001146481)
Plasmid#76350Purpose3rd generation lentiviral gRNA plasmid targeting human ROCK2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
sTR056
Plasmid#177369PurposeToehold switch, with an unpaired toehold region at the 5′-end that interacts with the trigger RNA (sTR060, Addgene plasmid # 177370) to unfold the switch.DepositorInsertsfGFP
UseSynthetic Biology; Cell-free protein synthesisAvailable SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
sTR060
Plasmid#177370PurposeTrigger RNA (GCAGGGATAAACGAGATAGATAAGATAAGA) that pairs with the toehold region in sTR056 (Addgene plasmid #177369) to restore translational activity.DepositorInsertTrigger RNA
UseSynthetic Biology; Cell-free protein synthesisAvailable SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only