We narrowed to 11,455 results for: ARIA
-
Plasmid#195375PurposeMammalian expression of a human PTPN22 mutant (exon 1-17) with FLAG tagDepositorInsertPTPN22 (PTPN22 Human)
TagsFLAGExpressionMammalianMutationPTPN22 mutant containing exon 1 to 17Available SinceMarch 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGADT7-γ1
Plasmid#197078PurposeExpression of GAL4 transcriptional activation domain (AD)-AP-1 γ1 fusion protein in yeast (yeast two-hybrid or yeast three-hybrid assays)DepositorInsertAP-1 γ1 (Ap1g1 Mouse)
TagsGAL4 transcriptional activation domain (AD) fragm…ExpressionYeastPromoterADH1Available SinceMarch 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)-Cue1pTM-MYC-UBE2G2
Plasmid#185346PurposeMembrane anchoring of UBE2G2. Encodes transmembrane domain of S. Cerevisiae Cue1p fused to MYC-UBE2G2DepositorInsertCue1p/Ube2G2 fusion (internal MYC tag)
ExpressionMammalianAvailable SinceFeb. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)-Cue1pTM-MYC-UBE2G2-FLAG
Plasmid#185347PurposeMembrane anchoring of UBE2G2 and co-IP. Encodes transmembrane domain of S. Cerevisiae Cue1p fused to MYC-UBE2G2 with C-terminal FLAG tagDepositorInsertCue1p/Ube2G2 fusion (internal MYC tag)
TagsFLAGExpressionMammalianAvailable SinceFeb. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
P2061
Plasmid#186299PurposeExpresses LexA-HBD-B112 under the control of pAct1 and Cas9 under the control of LexA-HBD-B112+Beta-estradiol inducible promoterDepositorInsertsLexA-HBD-B112
Cas9
UseCRISPR and Synthetic BiologyExpressionBacterial and YeastPromoter2xLexop-minimalCyc1 and PACT1Available SinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-DR30(sapI)-CMV-intron-hfCas13d-pA
Plasmid#195865PurposeTo express hfCas13dDepositorInserthigh fidelity (hf) version of CasRx (hfCas13d)
UseAAVMutationYes: GTGGAATACATTACCAACGTGGTGTACGTGPromoterCMVAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-intron-DIO-hfCas13d-pA
Plasmid#195866PurposeTo express hfCas13dDepositorInserthigh fidelity (hf) version of CasRx (hfCas13d)
UseAAVMutationYes: GTGGAATACATTACCAACGTGGTGTACGTGPromoterCMVAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3_HTR2A-NTEV-TCS-GV-2xHA
Plasmid#194366PurposeSplit TEV assaysDepositorAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3_SP-AVPR2-NTEV-TCS-GV-2xHA
Plasmid#194371PurposeSplit TEV assaysDepositorInsertSP-AVPR2-NTEV-TCS-GV-2xHA (AVPR2 Synthetic, Human)
Tags2xHAExpressionMammalianPromoterCMVAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3_SP-GLP1R-NTEV-TCS-GV-2xHA
Plasmid#194379PurposeSplit TEV assaysDepositorInsertSP-GLP1R-NTEV-TCS-GV-2xHA (GLP1R Synthetic, Human)
Tags2xHAExpressionMammalianPromoterCMVAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3_SP-DRD1-NTEV-TCS-GV-2xHA
Plasmid#194359PurposeSplit TEV assaysDepositorAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3_DRD1-V2R-NTEV-TCS-GV-2xHA
Plasmid#194360PurposeSplit TEV assaysDepositorInsertDRD1-V2R-NTEV-TCS-GV-2xHA (DRD1 Synthetic, Human)
Tags2xHAExpressionMammalianPromoterCMVAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3_DRD2-NTEV-TCS-GV-2xHA
Plasmid#194362PurposeSplit TEV assaysDepositorAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
LentiU6-hIL1RN gRNA_1-MS2-Puro
Plasmid#192677PurposeLentiviral expression of sgRNA targeting hIL1RN promoter to activate human IL1RN transcriptionDepositorInsertHuman IL1RN activating gRNA #1 (IL1RN Human)
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceDec. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
mTln1-F2-pET151
Plasmid#177870PurposeExpresses mouse Talin 1 F2 domain in bacterial cellsDepositorInsertmouse Talin 1 F2 domain (Tln1 Mouse)
TagsHis-tag, TEV cleavage siteExpressionBacterialPromoterT7Available SinceSept. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
mTln1-F2F3-pET151
Plasmid#177877PurposeExpresses mouse Talin 1 F2F3 domains in bacterial cellsDepositorInsertmouse Talin 1 F2F3 domain (Tln1 Mouse)
TagsHis-tag, TEV cleavage siteExpressionBacterialPromoterT7Available SinceSept. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
-
piwi_sgRNA
Plasmid#186653Purposepiwi sgRNA plasmidDepositorInsertPiwi sgRNA Plasmid (piwi Fly)
ExpressionInsectAvailable SinceAug. 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
Nbr_C_sgRNA2
Plasmid#186664PurposeNbr C-tag sgRNA2 plasmidDepositorInsertNbr sgRNA 2 Plasmid (Nbr Fly)
ExpressionInsectAvailable SinceJuly 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
Nbr_C_sgRNA1
Plasmid#186663PurposeNbr C-tag sgRNA1 plasmidDepositorInsertNbr sgRNA 1 Plasmid (Nbr Fly)
ExpressionInsectAvailable SinceJuly 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
-
Cas9_nonPuro_OSS
Plasmid#186652PurposeCas9 plasmid to express the Cas9 in OSS cellsDepositorInsertOSS Cas9 Expression Plasmid
ExpressionInsectAvailable SinceJuly 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
-
DHN_VrDHN1a_mCh-2xFKBP (pBS1117)
Plasmid#185312PurposeFor the mammalian expression of the riverbank grape plant protein DHN_VrDHN1a attached to 2xFKBP. The FKBP can be used for inducible dimerization and condensate formationDepositorInsertDHN_VrDHN1a
ExpressionMammalianAvailable SinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pST_DHN_VrDHN1a (or YSK2) (pBS0807)
Plasmid#185266PurposeFor the mammalian expression of the riverbank grape plant protein DHN_VrDHN1a (or YSK2). This is one of the top performing targets in our apoptosis assay (it protected from apoptosis).DepositorInsertDHN_VrDHN1a (or YSK2)
ExpressionMammalianAvailable SinceJune 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1α1.1-FLEX-rc [ChromeQ-GFP]
Plasmid#153542PurposeAAV-mediated expression of ChromeQ-GFP under the EF1α promoter (1.1kb short version), in floxed/reversed (Cre-dependent) manner.DepositorInsertChromeQ-GFP
UseAAVTagsGFPExpressionMammalianPromoterEF1α1.1Available SinceAug. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1α1.1-FLEX-rc [ChromeT-GFP]
Plasmid#153541PurposeAAV-mediated expression of ChromeT-GFP under the EF1α promoter (1.1kb short version), in floxed/reversed (Cre-dependent) manner.DepositorInsertChromeT-GFP
UseAAVTagsGFPExpressionMammalianPromoterEF1α1.1Available SinceAug. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
Equalizer-L plasmid with onboard mCherry cassette
Plasmid#169735PurposeEqualizer-L plasmid that encodes eGFP to report circuit output levels. This plasmid also encodes a separate mCherry expression cassette to monitor plasmid dosage.DepositorInsertmiR(FF4) target-tetR-P2A-eGFP-miR(FF4) target-miR(FF4)
UseSynthetic BiologyExpressionMammalianPromoterCMV-tetO2Available SinceJune 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBW_0007
Plasmid#102839PurposeBinary vector containing Sr22 PI573523 allele driven by Sr33 promoter, Sr33 terminatorDepositorAvailable SinceFeb. 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBW_0002
Plasmid#102834PurposeBinary vector containing Sr22 Schomburgk allele driven by Sr33 promoter, Sr33 terminatorDepositorAvailable SinceFeb. 5, 2021AvailabilityAcademic Institutions and Nonprofits only