We narrowed to 24,502 results for: crispr
-
Plasmid#183411PurposepiggyBAC-based sgRNA entry (Esp3I) and Tet-On 3G transactivator expression vector. Insert protospacer and transfect with CRISPRa (183409) or CRISPRi (183410) plasmid for inducible epigenome editing.DepositorInsertTet-on 3G
UseCRISPR and Synthetic Biology; PiggybacExpressionMammalianPromoterEF1AAvailable SinceMay 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pmCherry-U6-empty
Plasmid#140580PurposeExpresses a gRNA and mCherry in mammalian cellsDepositorTypeEmpty backboneUseCRISPRAvailable SinceMay 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pM-Cas12a
Plasmid#196291Purpose35S promoter-driven expression of the positive-sense TSWV M RNA segment encoding LbCas12a in place of viral GPDepositorInsertFull length TSWV M antigenome encoding LbCas12a in place of viral GP (cas12a Synthetic)
UseCRISPRTagsFlagExpressionPlantMutationSee depositor comments belowPromoterduplicated cauliflower mosaic virus 35S promoterAvailable SinceMay 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMK278 (mClover-Hygro)
Plasmid#72794PurposeC-terminal tagging with mClover using CRIPSR/Cas9DepositorInsertmClover-Hygro
UseCRISPRTagsmCloverExpressionMammalianAvailable SinceMarch 24, 2016AvailabilityAcademic Institutions and Nonprofits only -
pX330_human CDK1
Plasmid#118597PurposeOne shot system to create CDK1as human cells. Encode Cas9 and guideRNA to inactivate human CDK1 gene.DepositorInsertguide RNA against human CDK1
UseCRISPRAvailable SinceJan. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMS050
Plasmid#91826PurposeCodon-optimized mScarlet-I donor for the SapTrap cloning systemDepositorInsertmScarlet-I-C1
UseCRISPRExpressionWormAvailable SinceJune 23, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCFD5-NS
Plasmid#149546PurposeExpression of pegRNA(s) and sgRNA(s) under control of Drosophila U6:3 promoter. NS stands for "No Scaffold". Can be used to generate transgenic flies with vermillion+ selection.DepositorTypeEmpty backboneUseCRISPRExpressionInsectPromoterU6Available SinceAug. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSLQ2842 pPB: CAG-GID1-VPR-IRES-Zeo-WPRE PGK-GAI-tagBFP-SadCas9
Plasmid#84244PurposeExpresses GA-inducible VPR-Sa dCas9DepositorInsertsGAI-tagBFP-Sa dCas9
GID1-VPR
UseCRISPR and Synthetic Biology; PiggybacTagsGAI-tagBFP-Nucleoplasmin NLS, GID1, IRES-Zeocin, …ExpressionMammalianMutationD10A, N580A and Synonymous mutation in PYL1 to re…PromoterCAG and PGKAvailable SinceNov. 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
pRDA_118
Plasmid#133459PurposeU6 promoter expresses customizable Spyo-guide; EF1a promoter provides puromycin resistance. This vector is a derivative of the lentiGuide vector, with minor modifications to the tracrRDepositorInsertcontrol guide
UseCRISPR and LentiviralExpressionMammalianAvailable SinceOct. 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pT-GEM(0)
Plasmid#62891PurposeTrojan-Gal4 Expression Module in Phase 0. Insert T2A-Gal4 to genomic loci using the Crispr/Cas technology. Can be converted by cassette exchange into other Trojan exonsDepositorTypeEmpty backboneAvailable SinceJuly 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pRDA_429
Plasmid#179098PurposeBE Cas expressionDepositorInsertABE8e (Cas9-NG)
UseCRISPR and LentiviralAvailable SinceJan. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAc5 HA3-eDHFR-T2A-puro
Plasmid#86395Purposefor C-terminal tagging with eDHFR trimethoprim regulated degron with puro selectionDepositorInsertHA3 eDHFR T2A puro
UseCRISPRTagsHA3 eDHFR T2A puroMutationR12Y, G67S and Y100I mutations in E coli DHFRAvailable SinceMarch 9, 2017AvailabilityAcademic Institutions and Nonprofits only -
pET-6His-MBP-MpAgo
Plasmid#79249PurposeThis plasmid encodes the Argonaute protein from Marinitoga Piezophila and is codon optimized for E. coli expressionDepositorInsertMarinitoga piezophila Argonaute
UseCRISPRTags6XHis-tag + MBP + PreScission Cleavage SiteExpressionBacterialPromoterT7Available SinceJuly 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMK283 (Stag-3FLAG-Neo)
Plasmid#72799PurposeC-terminal tagging with Stag-3FLAG using CRIPSR/Cas9DepositorInsertStag-3FLAG-Neo
UseCRISPRTagsStag-3FLAGExpressionMammalianAvailable SinceMarch 24, 2016AvailabilityAcademic Institutions and Nonprofits only -
pS-cr:GFP
Plasmid#196295Purpose35S promoter-driven expression of the positive-sense TSWV S RNA segment encoding crRNA:GFP fusion in place of the NSsDepositorInsertFull length TSWV S antigenome encoding crRNA:GFP fusion in place of viral NSs
UseCRISPRTagsSpeI-DR-BsaI-DR-SpeIExpressionPlantPromoterduplicated cauliflower mosaic virus 35S promoterAvailable SinceApril 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
v3em-Cterm-PE6d-dualU6-Rosa26-twinPE-attB
Plasmid#207860PurposeAAV genome encoding C-terminal PE6d and U6 expression cassettes for Rosa26 twinPE pegRNA pairsDepositorInsertNpuC-Cterm-PE6d-dualU6-Rosa26-twinPE-attB
UseAAVMutationSee ManuscriptPromoterCbhAvailable SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCRISPaint-T2A-Gal4-3xP3-RFP
Plasmid#127556PurposeCRISPaint universal donor plasmid for gene exon insertion. Encodes T2A-Gal4-SV40 and 3xP3-RFP visible eye marker.DepositorInsertGal4
UseCRISPRExpressionInsectAvailable SinceAug. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1345 U6-B2M sgRNA Gag-Cas9 v2
Plasmid#201916PurposeCas9-EDV production plasmid. Expresses the v2 Gag-Cas9 polypeptide (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-Cas9 v2
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
TLCV2-APOBEC1-YTH
Plasmid#178949PurposeLentiviral vector for dox-inducible expression of APOBEC1-YTH in mammalian cellsDepositorInsertAPOBEC1-YTH-T2A-GFP
UseLentiviral and Synthetic Biology; InducibleTagsHAExpressionMammalianPromotertight TREAvailable SinceApril 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSCB2-sgRNA
Plasmid#129463PurposeTemplate plasmid for guide sequence insertion via inverse PCR. Derived from pSCrhaB2-gRNA (see paper).DepositorInsertpgRNA
UseCRISPRExpressionBacterialPromoterBBa_J23119 (SpeI)Available SinceSept. 30, 2019AvailabilityAcademic Institutions and Nonprofits only