We narrowed to 41,867 results for: LAT
-
Plasmid#129041Purposeinactivated control (targeted DNA demethylation_human_TSDR), expression of dCas9-hudTET1CD-T2A-mCherry sgRNA1 targeting human TSDRDepositorInsertdCas9-hudTET1CD, SgRNA1 (huTSDR)
TagsHA-Tag, NLS and T2A-mCherryExpressionMammalianMutationdCas9 (D10A;H840A), catalytic domain huTET1 inact…PromoterCbH (for dCas9-hudTET1CD-T2A-EGFP) U6 (for sgRNA)Available SinceJan. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pVD1 tRNA-gRNA position E3 (GB2240)
Plasmid#160562PurposetRNA and scaffold for the assembly of GBoligomers for the third position (positon [D3_4]) of a polycistronic tRNA-gRNA regulated by the U6-26 or U6-1 promoterDepositorInserttRNA-gRNA position E3 (Multiplexing Edit)
UseCRISPR and Synthetic BiologyMutationBsaI and BsmBI sites removedAvailable SinceMarch 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
sgALK(Chr. Inv.)
Plasmid#85569PurposeExpresses sgRNA targeting human ALK between exon 20 and 21DepositorInsertanaplastic lymphoma receptor tyrosine kinase (ALK Human)
ExpressionMammalianAvailable SinceFeb. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDONR P2R-P3-IRES_ECFP
Plasmid#48354PurposeContributes an IRES-ECFP cassette as the 3’-module during MultiSite Gateway cloning of a bi-cistronic mRNA shared with a two-part fusion protein encoded by the 5′- and middle modules.DepositorInsertIRES_ECFP
UseGateway entry vectorMutationECFP translation is mediated by an IRES. Contains…PromoternoneAvailable SinceApril 9, 2014AvailabilityAcademic Institutions and Nonprofits only -
pTU1-A-gap_RiboJ_GFP+_MGApt_Bba_B0015
Plasmid#107577PurposeB. megaterium DSM319 gap promoter, GFP+ with malachite green mRNA aptamer for Bacillus cell-free transcription-translation. Bacillus shuttle vector backbone, colE1/AmpR (E. coli), RebB/TetA (Bacillus)DepositorInsertGFP+
UseSynthetic Biology; E. coli and bacillus shuttle v…TagsB. megaterium DSM319 xylA leader sequence (MTSSKI…ExpressionBacterialMutationF64L/ S65T/ Q80R/ F99S/ M153T/ V163APromotergapdh promoter - B. megaterium DSM319Available SinceApril 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
-
Mirror GFP[ENE(C8351G)-mascRNA(mut 8356-8370)](pAVA3871)
Plasmid#239352PurposeExpresses TEV protease and tandemly-repeated GFP fluorescent proteins to amplify the fluorescence signal produced by a single transcription unit of MALAT1 ENE(C8351G)-mascRNA(mut 8356-8370) reporter.DepositorInsertMALAT1 ENE(C8351G)-mascRNA(mut 8356-8370)
ExpressionMammalianMutationMALAT1 ENE(C8351G)-mascRNA(mut 8356-8370: ctacgac…Available SinceAug. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
FLAG-GRP78-No UTRs AAA Mutant (pcDNA3.1)
Plasmid#238430PurposeExpresses GRP78 AAA mutant without the UTRs fused to FLAG tagDepositorInsert78-kDa glucose-regulated protein (HSPA5 Human)
TagsFLAGExpressionMammalianMutationThe UTRs of the gene have been deleted. The PPP t…Available SinceJune 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR V2 Neo sgITGB1_3
Plasmid#233250PurposeKnock out of murine ITGB1DepositorInsertITGB1 (Itgb1 Mouse)
UseLentiviralAvailable SinceMarch 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR V2 Neo sgITGB1_2
Plasmid#233249PurposeKnock out of murine ITGB1DepositorInsertITGB1 (Itgb1 Mouse)
UseLentiviralAvailable SinceMarch 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDONOR-MARINA
Plasmid#223328PurposeDONOR vector for genomic integration of MARINA voltage sensitive indicator gene from Platisa et al., 2017 (10.1021/acschemneuro.6b00234).DepositorInsertsMARINA
KIR2.1 channel Golgi-to-plasma membrane trafficking signal
UseCRISPR and Synthetic BiologyTagsmCherry and super-ecliptic pHluorinExpressionMammalianPromoterCAGAvailable SinceDec. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDonor-FMR1-CGG-BsmBI
Plasmid#222966Purpose0CGG with BsmBI site for inserting CGG repeatsDepositorInsertFMR1 homologous template (no CGG repeats) with cloning site (FMR1 Human)
UseCRISPRMutationCGG repeats deleted from 5' UTR, BsmBI site …Available SinceSept. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-hSyn-scFVDnmt3AL_bGHpA
Plasmid#177348PurposeAAV expression of a fusion protein with scFV, catalytic domain of Dnmt3a and C terminal domain of Dnmt3l from Synapisin promoter for targeted DNA methylation editingDepositorInsertcatalytic domain of DNA Methyltransferase 3 Alpha (Dnmt3a Mouse)
UseAAVTagsC-terminal domain of mouse Dnmt3l (194–415 aa), P…ExpressionMammalianMutation598–908 aa of mouse Dnmt3aPromoterhuman SynapsineAvailable SinceSept. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-TRE-scFVDnmt3AL_bGHpA
Plasmid#177354PurposeAAV expression of a fusion protein with scFV, catalytic domain of Dnmt3a and C terminal domain of Dnmt3l from doxycycine-inducible promoter for targeted DNA methylation editingDepositorInsertcatalytic domain of DNA Methyltransferase 3 Alpha (Dnmt3a Mouse)
UseAAVTagsC-terminal domain of mouse Dnmt3l (194–415 aa), P…ExpressionMammalianMutation598–908 aa of mouse Dnmt3aPromoterTetracycline-dependent promoterAvailable SinceSept. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-TRE-scFVDnmt3A_bGHpA
Plasmid#177355PurposeAAV expression of scFV-fused catalytic domain of Dnmt3a from doxycycine-inducible promoter for targeted DNA methylation editingDepositorInsertcatalytic domain of DNA Methyltransferase 3 Alpha (Dnmt3a Mouse)
UseAAVTagsmyc and scFVExpressionMammalianMutation598–908 aa of mouse Dnmt3aPromoterTetracycline-dependent promoterAvailable SinceSept. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-TRE-scFVtet1_bGHpA
Plasmid#177357PurposeAAV expression of scFV-fused catalytic domain of TET1 from doxycycine-inducible promoter for targeted DNA methylation editingDepositorInsertTet Methylcytosine Dioxygenase 1 (TET1 Human)
UseAAVTagsmyc and scFVExpressionMammalianMutationN terminal domain of human Tet1PromoterTetracycline-dependent promoterAvailable SinceSept. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
Anti-Keyhole limpet hemocyanin [N132A/12R]
Plasmid#206532PurposeMammalian Expression Plasmid of anti-Keyhole limpet hemocyanin (Giant keyhole limpet). Derived from hybridoma N132A/12.DepositorInsertanti-Keyhole limpet hemocyanin (Megathura crenulata) recombinant Mouse monoclonal antibody
ExpressionMammalianPromoterDual CMVAvailable SinceMarch 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCAG-lox-inv[Talpha1-Dre-PA]-lox-2xHA-CAMSAP3
Plasmid#196895PurposeNeuron-specific expression of Calmodulin Regulated Spectrin Associated Protein Family Member 3 (CAMSAP3) fused to 2xHA-tags. Used in combination with Talpha1-iCre-pA plasmidsDepositorAvailable SinceMay 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMXS-IRES-Blast 3XFLAG-CHP1-myr_mut
Plasmid#173167PurposeRetroviral vector to express sgRNA resistant 3XFLAG tagged human CHP1 with myristoylation site mutationDepositorInsertCalcineurin Like EF-Hand Protein 1 (CHP1 Human)
UseRetroviralTags3XFLAGMutationSynonymous mutations at sgRNA sites, G2A, S6APromoterMMLVAvailable SinceAug. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSpdCas9-hudTET1CD-T2A-mCherry(PX458)-SghuTSDR-7
Plasmid#129047Purposeinactivated control (targeted DNA demethylation_human_TSDR), expression of dCas9-hudTET1CD-T2A-mCherry sgRNA7 targeting human TSDRDepositorInsertdCas9-hudTET1CD, SgRNA7 (huTSDR)
TagsHA-Tag, NLS and T2A-mCherryExpressionMammalianMutationdCas9 (D10A;H840A), catalytic domain huTET1 inact…PromoterCbH (for dCas9-hudTET1CD-T2A-EGFP) U6 (for sgRNA)Available SinceJan. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSpdCas9-hudTET1CD-T2A-mCherry(PX458)-SghuTSDR-9
Plasmid#129049Purposeinactivated control (targeted DNA demethylation_human_TSDR), expression of dCas9-hudTET1CD-T2A-mCherry sgRNA9 targeting human TSDRDepositorInsertdCas9-hudTET1CD, SgRNA9 (huTSDR)
TagsHA-Tag, NLS and T2A-mCherryExpressionMammalianMutationdCas9 (D10A;H840A), catalytic domain huTET1 inact…PromoterCbH (for dCas9-hudTET1CD-T2A-EGFP) U6 (for sgRNA)Available SinceJan. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSpdCas9-hudTET1CD-T2A-mCherry(PX458)-SghuTSDR-10
Plasmid#129050Purposeinactivated control (targeted DNA demethylation_human_TSDR), expression of dCas9-hudTET1CD-T2A-mCherry sgRNA10 targeting human TSDRDepositorInsertdCas9-hudTET1CD, SgRNA10 (huTSDR)
TagsHA-Tag, NLS and T2A-mCherryExpressionMammalianMutationdCas9 (D10A;H840A), catalytic domain huTET1 inact…PromoterCbH (for dCas9-hudTET1CD-T2A-EGFP) U6 (for sgRNA)Available SinceJan. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSpdCas9-hudTET1CD-T2A-mCherry(PX458)-SghuTSDR-11
Plasmid#129051Purposeinactivated control (targeted DNA demethylation_human_TSDR), expression of dCas9-hudTET1CD-T2A-mCherry sgRNA11 targeting human TSDRDepositorInsertdCas9-hudTET1CD, SgRNA11 (huTSDR)
TagsHA-Tag, NLS and T2A-mCherryExpressionMammalianMutationdCas9 (D10A;H840A), catalytic domain huTET1 inact…PromoterCbH (for dCas9-hudTET1CD-T2A-EGFP) U6 (for sgRNA)Available SinceJan. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSpdCas9-hudTET1CD-T2A-mCherry(PX458)-SghuTSDR-12
Plasmid#129052Purposeinactivated control (targeted DNA demethylation_human_TSDR), expression of dCas9-hudTET1CD-T2A-mCherry sgRNA12 targeting human TSDRDepositorInsertdCas9-hudTET1CD, SgRNA12 (huTSDR)
TagsHA-Tag, NLS and T2A-mCherryExpressionMammalianMutationdCas9 (D10A;H840A), catalytic domain huTET1 inact…PromoterCbH (for dCas9-hudTET1CD-T2A-EGFP) U6 (for sgRNA)Available SinceJan. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSpdCas9-hudTET1CD-T2A-mCherry(PX458)-SghuTSDR-3
Plasmid#129043Purposeinactivated control (targeted DNA demethylation_human_TSDR), expression of dCas9-hudTET1CD-T2A-mCherry sgRNA3 targeting human TSDRDepositorInsertdCas9-hudTET1CD, SgRNA3 (huTSDR)
TagsHA-Tag, NLS and T2A-mCherryExpressionMammalianMutationdCas9 (D10A;H840A), catalytic domain huTET1 inact…PromoterCbH (for dCas9-hudTET1CD-T2A-EGFP) U6 (for sgRNA)Available SinceJan. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSpdCas9-hudTET1CD-T2A-mCherry(PX458)-SghuTSDR-4
Plasmid#129044Purposeinactivated control (targeted DNA demethylation_human_TSDR), expression of dCas9-hudTET1CD-T2A-mCherry sgRNA4 targeting human TSDRDepositorInsertdCas9-hudTET1CD, SgRNA4 (huTSDR)
TagsHA-Tag, NLS and T2A-mCherryExpressionMammalianMutationdCas9 (D10A;H840A), catalytic domain huTET1 inact…PromoterCbH (for dCas9-hudTET1CD-T2A-EGFP) U6 (for sgRNA)Available SinceJan. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSpdCas9-hudTET1CD-T2A-mCherry(PX458)-SghuTSDR-5
Plasmid#129045Purposeinactivated control (targeted DNA demethylation_human_TSDR), expression of dCas9-hudTET1CD-T2A-mCherry sgRNA5 targeting human TSDRDepositorInsertdCas9-hudTET1CD, SgRNA5 (huTSDR)
TagsHA-Tag, NLS and T2A-mCherryExpressionMammalianMutationdCas9 (D10A;H840A), catalytic domain huTET1 inact…PromoterCbH (for dCas9-hudTET1CD-T2A-EGFP) U6 (for sgRNA)Available SinceJan. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSpdCas9-hudTET1CD-T2A-mCherry(PX458)-SghuTSDR-6
Plasmid#129046Purposeinactivated control (targeted DNA demethylation_human_TSDR), expression of dCas9-hudTET1CD-T2A-mCherry sgRNA6 targeting human TSDRDepositorInsertdCas9-hudTET1CD, SgRNA6 (huTSDR)
TagsHA-Tag, NLS and T2A-mCherryExpressionMammalianMutationdCas9 (D10A;H840A), catalytic domain huTET1 inact…PromoterCbH (for dCas9-hudTET1CD-T2A-EGFP) U6 (for sgRNA)Available SinceJan. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shARL4C.1
Plasmid#110320PurposeTRCN0000048179 (Target GTCCCTGCATATCGTCATGTT), silence human ARL4C gene and express monomeric Kusabira-Orange2DepositorInsertARL4C (ARL4C Human, Homo sapiens)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceAug. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -