We narrowed to 7,826 results for: 11
-
Plasmid#74231PurposeGFP-Ago2 lentiviral vectorDepositorAvailable SinceApril 6, 2016AvailabilityAcademic Institutions and Nonprofits only
-
pAAV-EFS-fDIO-GRAB_eCB2.0
Plasmid#164610PurposeExpress the endocannabinoid sensor GRAB_eCB2.0 in FLP positive cellsDepositorInsertEndocannabinoid sensor GRAB_eCB2.0
UseAAVMutationS383TPromoterEFSAvailable SinceFeb. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLenti-Blast-sgNT
Plasmid#138678PurposeExpresses a Non-targeting sgRNA and Cas9DepositorInsertsgNT
UseLentiviralPromoterhU6Available SinceFeb. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHR_PGK_antiCD19_eZ3_Gal4VP64
Plasmid#169917PurposeExpression of a synNotch receptor containing antiCD19, a zebrafish Notch3 core with an additional EGF repeat, and Gal4VP64.DepositorInsertantiCD19-Notch3-GL4VP64
UseLentiviralExpressionMammalianMutationAdditional EGF repeat between the extracellular d…PromoterPGKAvailable SinceJuly 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO-GRAB_eCB2.0mut
Plasmid#164607PurposeExpress the endocannabinoid non-responsive sensor GRAB_eCB2.0 in Cre positive neuronsDepositorInsertEndocannabinoid non-responsive sensor GRAB_eCBmut
UseAAVMutationS383T, F177APromoterhSynAvailable SinceFeb. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCKC775
Plasmid#226626PurposepiggyBAC 7xTCF-LEF hCas9-T2A-A/T-biased2DepositorInsertsUseSynthetic BiologyExpressionMammalianPromoter7xTCF-LEF and EF1aAvailable SinceOct. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCKC764
Plasmid#226625PurposepiggyBAC pCAG-hCas9-T2A-Unbiased3DepositorInsertsCAG promoter, SpCas9, T2A, Unbiased3 variant of TdT (DNTT S. pyogenes, Human, Chicken)
EF1a promoter, blasticidin resistance
UseSynthetic BiologyExpressionMammalianPromoterCMV and EF1aAvailable SinceOct. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCKC776
Plasmid#226627PurposepiggyBAC 4xHRE YB_TATA hCas9-T2A-G/C-biased1DepositorInserts4x HRE_YB TATA, SpCas9, oxygen-dependent degron, T2A, G/C-biased1 variant of TdT (DNTT Human, S. pyogenes)
EF1a promoter, mCherry
UseSynthetic BiologyTagsoxygen dependent degron (ODD)ExpressionMammalianPromoter4xHRE_YB TATA and EF1aAvailable SinceOct. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
Chicken Mermaid S188
Plasmid#53617PurposeGenetically encoded voltage sensor based on mUKG-mKOk FRET pairDepositorInsertChicken Mermaid S188
ExpressionMammalianMutationGg-VSP contains an R153Q mutation and an amino ac…PromoterCMVAvailable SinceAug. 18, 2014AvailabilityAcademic Institutions and Nonprofits only -
pTet-GLI2shR
Plasmid#136691PurposeInducible Gli2 shRNA lentiviral plasmid (target sequence: human GLI2 5′CCGGCCTGGCATGACTACCACTATGCTCGAGCATAGTGGTAGTCATGCCAGGTTTTTG 3′)DepositorInsertshRNA_humanGli2 (GLI2 Human)
UseLentiviralAvailable SinceJune 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pFrt-invCAG-ires-Luc
Plasmid#63576PurposeShuttle vector compatible with Flp-mediated (Flp-in) transgene integration that allows for conditional cDNA and Luc expression upon integration. The vector contains an FRT site and two mut loxP sites.DepositorInsertStop-Lox71-IRES-Luciferase-pA-FRT-Lox66-reverseCAG
UseCre/Lox; Frt/flpe recombination mediated insertionExpressionMammalianPromoterCAGAvailable SinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pZac2.1 SV40-CMV-SaCas9-3xNLS
Plasmid#78601PurposeAAV vector containing SaCas9DepositorInsertSV40-CMV-SaCas9-3xNLS
UseAAV and CRISPRTagsHA tagExpressionMammalianPromoterSV40, CMV promotersAvailable SinceDec. 2, 2017AvailabilityAcademic Institutions and Nonprofits only -
STARR-seq luciferase INF enhancer vector_ORI_MX1
Plasmid#99323PurposeLuciferase validation vector with MX1 enhancer inserted downstream of the reporter gene. The candidate's enhancer activity is reflected by luciferase activityDepositorInsertenhancer; chr21: 42791443 -42793515
UseLuciferase; Starr-seq luciferase validation vectorExpressionMammalianAvailable SinceOct. 23, 2017AvailabilityAcademic Institutions and Nonprofits only -
STARR-seq luciferase INF enhancer vector_ORI_IFIT2
Plasmid#99321PurposeLuciferase validation vector with IFIT2 enhancer inserted downstream of the reporter gene. The candidate's enhancer activity is reflected by luciferase activityDepositorInsertenhancer; chr10: 91060605-91062447
UseLuciferase; Starr-seq luciferase validation vectorExpressionMammalianAvailable SinceAug. 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
CMV-FLAG-TAOK2
Plasmid#197862PurposeExpression of FLAG-tagged TAOK2 / PSK1 alpha in mammalian cellsDepositorAvailable SinceMarch 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCRI005-pYFAC-riboB-PgpdA-dLbCpf1(D156R)-VPR-TtrpC
Plasmid#140198PurposeEpisomal expression of dLbCpf1(D156R)-VPR, variant for culture at room temperature. Filamentous fungi vector with AMA1 and riboB selection marker.DepositorInsertdLbCas12a(D156R)-VPR
UseCRISPR and Synthetic Biology; Expression in asper…TagsVPR (VP64-p65-Rta), NLSMutationD832A DNase deactivated, D156R for improved activ…PromoterPgpdAAvailable SinceSept. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCSIIpuro-BTC-ScNeo
Plasmid#209898PurposeTo monitor the status of Betacellulin, the plasmid encodes a recombinant BTC fused extracellularly to the mScarlet fluorescent protein and intracellularly to the mNeonGreen fluorescent proteinDepositorAvailable SinceNov. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCSIIpuro-Necl5-ScNeo
Plasmid#209901PurposeTo monitor the status of Necl-5, the plasmid encodes a recombinant Necl-5 fused extracellularly to the mScarlet fluorescent protein and intracellularly to the mNeonGreen fluorescent proteinDepositorAvailable SinceNov. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1.H1-NP
Plasmid#134367PurposeNanoluc complementation assay. Expression of histamine receptor H1 fused at C termimus with Natural peptide (NP) of NanoLuc. Addition of the Flag epitope at N terminus of H1 receptor.DepositorInsertH1-NP (HRH1 Human)
TagsFlag and natural peptide of nanoluciferaseExpressionBacterial and MammalianPromoterT7Available SinceJuly 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGEX-UAP56
Plasmid#157661PurposeExpresses UAP56 in E.coli cellDepositorInsertSpliceosome RNA helicase DDX39B (DDX39B Human)
TagsGST tagExpressionBacterialMutationdeleted amino acids 1-43Available SinceAug. 20, 2020AvailabilityAcademic Institutions and Nonprofits only