We narrowed to 154,128 results for: ins;
-
Plasmid#124664PurposeExpresses SpyCatcher002-oPent for pentamerization of SpyTag-proteins via pentameric coiled-coilDepositorInsertSpyCatcher002-oPent
TagsC-tag, His6, and TEV cleavage siteExpressionBacterialPromoterT7Available SinceMay 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLVX-RT003-GPM
Plasmid#163383PurposeTo express sGFP module in the G-baToN systemDepositorInsertGFP-PDGFRtm-2A-mCherry (GPM)
UseLentiviralTagsmCherryExpressionBacterial and MammalianPromoterEF1aAvailable SinceJan. 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRXG
Plasmid#113643PurposeThis construct contains an amber stop codon within the linker between the two genes. The read through rate of the amber stop codon can be determined using the ratio of GFP signal to RFP signal.DepositorInsertmRFP1-linker-sfGFP
UseSynthetic BiologyAvailable SinceJuly 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pBad-LgBiT-PhoCl1-SmBiT-MBP
Plasmid#164034Purposeluciferase-based PhoCl screening constructDepositorInsertLgBiT-PhoCl1-SmBiT-MBP
TagsHis tag, T7 tag, Xpress TagExpressionBacterialPromoteraraBad promotorAvailable SinceFeb. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJL1 BSMT1
Plasmid#106287PurposeExpresses BSMT1 in Ecoli off a T7 promoterDepositorInsertBSMT1
ExpressionBacterialPromoterT7Available SinceAug. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
SpyCatcher002-oHept
Plasmid#124671PurposeExpresses SpyCatcher002-oHept for heptamerization of SpyTag-proteins via heptameric coiled-coilDepositorInsertSpyCatcher002-oHept
TagsC-tag, His6, and TEV cleavage siteExpressionBacterialPromoterT7Available SinceMay 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLinker-AID-3xHA-DHFR-LoxP
Plasmid#86669Purposefor generation of AID strains using CRISPR tagging technologyDepositorInsertLinker-AID-3xHA-HXGPRT 3'UTR
UseExpression in toxoplasma gondiiAvailable SinceMay 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
scFv-GCN4-sfGFP-TET1CD
Plasmid#184439PurposeTET1 catalytic domain fused with sfGFP and scFv against GCN4DepositorInsertscFv-GCN4-sfGFP-TET1CD
UseCRISPR and LentiviralExpressionMammalianAvailable SinceSept. 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCKmatBC
Plasmid#138587PurposematBC cassette from R. trifolii controlled by a Plac promoter; pSC101 ori, catDepositorInsertbicistronic cassette containing a malonate transporter (matC) and a malonyl-CoA synthetase (matB)
UseSynthetic BiologyExpressionBacterialMutationmatB contains native GUG start codonPromoterPlac promoterAvailable SinceMarch 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLKO.shNkx2-1
Plasmid#32400DepositorAvailable SinceSept. 27, 2011AvailabilityAcademic Institutions and Nonprofits only -
pRF0G-IodoY
Plasmid#113645PurposePlasmid contains the aminoacyl-tRNA synthetase and tRNA genes from methanococcus jannaschii for charging iodotyrosine at amber stop codons.DepositorInsertIodoYRS and tRNA gene
UseSynthetic BiologyAvailable SinceJuly 27, 2018AvailabilityIndustry, Academic Institutions, and Nonprofits -
pFB1_hMLH1
Plasmid#129426PurposeExpression human MLH1 protein using baculovirusDepositorAvailable SinceAug. 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLIC-lyn11-myc-LOV2GIVe
Plasmid#170623PurposeFor the mammalian expression of mLOV2GIVeDepositorInsertLyn11-myc-LOV2GIVe
TagsmycExpressionMammalianPromoterCMVAvailable SinceJune 29, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pMS59
Plasmid#215680PurposeCas9 + guide plasmid targeting ChrI split hygromycinR landing padDepositorInserteef-1A.1p::Cas9 + U6p::GTTTGAGTAGAGCACTCAGG
UseCRISPRExpressionWormAvailable SinceMarch 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSEM253 - sgRNA mosTI hygroR
Plasmid#159827PurposeSingle copy or array insertion by MosTI using split hygroR selectionDepositorInsertsgRNA mosTI hygroR
ExpressionWormMutationNot applicableAvailable SinceDec. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSEM270 - MCS mosTI hygroR target
Plasmid#159826PurposeSingle copy or array insertion by MosTI using split hygroR selectionDepositorInsertMCS mosTI hygroR target
ExpressionWormMutationNot applicableAvailable SinceDec. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
miReporter-PGK
Plasmid#82477PurposemicroRNA reporter relying on a bidirectional PGK promoter. Contains MCS downstream of H2B-mCherry and H2B-Citrine to insert miRNA binding sites. Contains a Hygromycin selection cassette.DepositorInsertH2B-mCherry and H2B-Citrine. HygroR
Available SinceSept. 16, 2016AvailabilityAcademic Institutions and Nonprofits only -
miReporter-CAG
Plasmid#82478PurposemicroRNA reporter relying on a bidirectional CAG-based promoter. Contains MCS downstream of H2B-mCherry and H2B-Citrine to insert miRNA binding sites. Contains a Hygromycin selection cassette.DepositorInsertH2B-mCherry and H2B-Citrine. HygroR
Available SinceFeb. 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
BPK3082
Plasmid#78742PurposeHuman expression plasmid for LbCpf1 guide RNA (need to clone in spacer into BsmBI sites)DepositorInsertLbCpf1 crRNA backbone, without spacer sequence
UseCRISPRExpressionMammalianPromoterU6Available SinceJune 16, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSO7
Plasmid#106365PurposeTo insert a single copy of a construct at a site on Chr I, corresponding to the Shigella flexneri protein OspF (a MAP kinase inhibitor) expressed specifically in the epidermis.DepositorInsertttTi4348_ SEC _pcol-19_OspF_3'unc54UTR
ExpressionWormAvailable SinceJuly 13, 2018AvailabilityAcademic Institutions and Nonprofits only