We narrowed to 10,056 results for: transfer
-
Plasmid#70118PurposePromoterless AAV plasmid with MCS to insert promoter for expression of EmGFP. Contains WPRE.DepositorInsertssAAV-MCS-EmGFP-WPRE
UseAAVExpressionMammalianPromoterPromoterlessAvailable SinceMay 12, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV hSyn1 CaRhAC T2A tDimer
Plasmid#101722Purpose- humanized - variant of pAAV hSyn YFP-CaRhAC Addgene # 101721– less reliable in hippocampal neuronsDepositorInsertsCatRhAC
red fluorescent protein
UseAAVMutationE497K,C569DPromoterhuman Synapsin1 promotor and ribosomal skip seque…Available SinceJan. 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
HT116_pAAV_hSyn-DiO-SomQuasAr6b_EGFP
Plasmid#190879PurposeCre-on expression of soma-targeted QuasAr6b under an neuronal promoterDepositorInsertsoma-targeted QuasAr6b
UseAAVTagsEGFPPromoterhSynAvailable SinceNov. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV.hSyn.FLEX.FAPdL5-POST-T2A-dTomato.FLEX.WPRE.SV40
Plasmid#105982PurposeThis AAV plasmid in the presence of Cre recombinase expresses an extracellular dL5 FAP fused to the neuroligin-1 cytoplasmic domain for targeting to the synapse with a cell fill dTomato.DepositorInsertFLEX-FAPdL5-POST-T2A-dTomato.FLEX
UseAAV and Cre/LoxTagsFAPdL5-POST, T2A-dTomato, and mycExpressionMammalianPromoterhuman synapsin 1Available SinceOct. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-eYFP-3x-miR204-5p-TS
Plasmid#117380PurposeAn AAV genome containing miRNA target sequence (TS) 204-5p to reduce expression of the fluorescent protein eYFP in astrocytesDepositorInsertEYFP + 3 copies of miR204 : AGGCATAGGATGACAAAGGGAA
UseAAVExpressionMammalianPromoterCAGAvailable SinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-CCre-MBP4-WPRE
Plasmid#193919PurposeExpresses one of the components of Cre-DOR_N5C4 (RFP-dependent Cre)DepositorInsertCCre-MBP4
UseAAV, Affinity Reagent/ Antibody, Cre/Lox, and Syn…ExpressionMammalianPromoterEF1aAvailable SinceJan. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-NCre-MBP5-WPRE
Plasmid#193918PurposeExpresses one of the components of Cre-DOR_N5C4 (RFP-dependent Cre)DepositorInsertNCre-MBP5
UseAAV, Affinity Reagent/ Antibody, Cre/Lox, and Syn…ExpressionMammalianPromoterEF1aAvailable SinceJan. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAC8_PH-GST-Nter-GWs-Lox (VE5586)
Plasmid#163766PurposeTransfer vector for gene expression to generate recombinant baculoviruses by homologous recombination. Contains expression cassette with an N-ter GST tag under the pH promoter.DepositorInsertN-terminal GST tag
TagsGST TagExpressionInsectPromoterPHAvailable SinceDec. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAV2_hSyn_Phobos_Citrine
Plasmid#98216PurposeBlue-shifted artificial anion conducting channelrhodopsin (aACR). Activation max 466 nm; off-kinetics 10 ms. Codon optimized for mammalian expression.DepositorInsertSynthetic construct Phobos gene
UseAAVTagsCitrineExpressionMammalianMutationT59S, E83N, E90Q, E101S, V117R, E123S, T159G, G16…Promoterhuman synapsinAvailable SinceAug. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEMS2112
Plasmid#49137PurposeAAV plasmid with NR2E1 (Ple264) promoter driving expression of EmGFP.DepositorInsertssAAV-Ple264-emGFP
UseAAVExpressionMammalianPromoterNR2E1Available SinceMay 10, 2016AvailabilityIndustry, Academic Institutions, and Nonprofits -
pAAV2_hSyn_NES-Caprola_04-mEGFP_WRPE-SV40
Plasmid#194688PurposehSyn1 driven expression of the calcium recorder Caprola_04 fused to mEGFP for neuronal expression through AAV transductionDepositorInsertCaprola_04-mEGFP
UseAAVTagsmEGFPPromoterhSyn1Available SinceFeb. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hGRM1-RFP
Plasmid#22920DepositorInserthuman receptor metabotropic 1 promoter driving DsRedExpress (GRM1 Human)
UseAAVExpressionMammalianAvailable SinceMay 25, 2010AvailabilityAcademic Institutions and Nonprofits only -
pEMS1980
Plasmid#49111PurposePromoterless AAV plasmid with MCS to insert promoter for expression of iCre.DepositorInsertssAAV-MCS-iCre
UseAAVExpressionMammalianPromoterPromoterlessAvailable SinceMay 10, 2016AvailabilityIndustry, Academic Institutions, and Nonprofits -
pAM-AAV-mSncg-0.66kb-EGFP
Plasmid#153165PurposeTruncated mouse gamma-synuclein (mSncg-0.66kb) promoter-mediates gene expression in retinal ganglion cells with fluorescent reporterDepositorTypeEmpty backboneUseAAVExpressionMammalianAvailable SinceJune 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-RSV-GFP-U6-Rosa26 gRNA (SpyCas9 scaffold)
Plasmid#120296PurposeAAV vector; encodes GFP as well as a U6-driven Rosa26-targeting gRNA (SpyCas9 scaffold)DepositorInsertRosa26 gRNA (SpCas9 scaffold)
UseAAV and CRISPRExpressionMammalianAvailable SinceJan. 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV TBG FFluc miR122sponge
Plasmid#35657DepositorInsertmiR-122 sponge
UseAAVPromoterTBGAvailable SinceJuly 11, 2012AvailabilityAcademic Institutions and Nonprofits only -
AAV2_hSyn_Aurora_Citrine
Plasmid#98217PurposeRed-shifted artificial anion conducting channelrhodopsin (aACR). Activation up to 600 nm; off-kinetics 260 ms. Codon optimized for mammalian expression.DepositorInsertSynthetic construct Aurora gene
UseAAVTagsCitrineExpressionMammalianMutationV59S, E83N, E90Q, E101S, V117R, E123S, P242R, A24…Promoterhuman synapsinAvailable SinceAug. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAVsc CB6PI Gpluc7XmiR-122T
Plasmid#35647DepositorInsert7 bulged miR-122 target sites
UseAAVPromoterCBAvailable SinceJuly 30, 2012AvailabilityAcademic Institutions and Nonprofits only -
pRetroX-Tight-Pur-Trim69 Full length, isoform A (codon optimized)
Plasmid#199566PurposeStable and dox. inducible expression of Trim69 Full length, isoform A (codon optimized) after retroviral-mediated gene transferDepositorInsertTrim69 Full length, isoform A (codon optimized) (TRIM69 Human)
UseRetroviral; Allows for puromycin selectionTagsFlagMutationcodon optimizedAvailable SinceMay 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEMS2260
Plasmid#158423PurposeAAV plasmid with Ple331 (PAX6 MiniPromoter) driving expression of EmGFP. Contains WPRE.DepositorAvailable SinceFeb. 4, 2021AvailabilityAcademic Institutions and Nonprofits only