We narrowed to 5,233 results for: puc
-
Plasmid#188273PurposeMammalian expression, Genome editingDepositorInsertPlmCasX
UseCRISPRExpressionMammalianMutationnonePromoterCAGAvailable SinceJuly 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCA28-pMa-PspCas13b crRNA-TS1
Plasmid#199459PurposeU6-driven crRNA targeting TS1 sequence (CCTCCTCGGAGAGCATCGGTGC )DepositorInsertTS1 crRNA
UseCRISPRPromotermouse U6Available SinceMay 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTS1041
Plasmid#169619PurposeTier-2 vector encoding PPGK-driven secreted Nluc coupled to fluorescent reporter mTagBFP2 (A1-pA::A2-pA::PmPGK1-IgkSS-Nluc-p2A-mTagBFP2-pA).DepositorInsertPPGK-driven expression of secreted Nluc and mTagBFP2
ExpressionMammalianPromoterPPGKAvailable SinceJuly 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTS1040
Plasmid#169618PurposeTier-2 vector encoding PPGK-driven secreted Nluc coupled to fluorescent reporter mTagBFP2 (A1-pA::PPGK-IgkSS-Nluc-p2A-mTagBFP2-pA::A3-pA).DepositorInsertPPGK-driven expression of secreted Nluc and mTagBFP2
ExpressionMammalianPromoterPPGKAvailable SinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
Rp51a Hyperstabilized 5'SS
Plasmid#100988PurposepUC18 Hyperstabilized Rp51a 5'SS between HindIII and EcoRI; ATG/GTATGT -> AAG/GTAAGTDepositorInsertRP51A (RPS17A Budding Yeast)
ExpressionBacterial and YeastMutation5'ss mut ATG/GTATGT -> AAG/GTAAGTAvailable SinceMarch 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pZNF561-donor
Plasmid#113801PurposeCRISPR donor plasmid to tag human transcription factor ZNF561 with GFPDepositorInsertZNF561 homology arms flanking EGFP-IRES-Neo cassette (ZNF561 Human)
UseCRISPRAvailable SinceDec. 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
pZNF700-donor
Plasmid#112385PurposeCRISPR donor plasmid to tag human transcription factor ZNF700 with GFPDepositorInsertZNF700 homology arms flanking EGFP-IRES-Neo cassette (ZNF700 Human)
UseCRISPRAvailable SinceDec. 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
pZNF169-donor
Plasmid#112376PurposeCRISPR donor plasmid to tag human transcription factor ZNF169 with GFPDepositorInsertZNF169 homology arms flanking EGFP-IRES-Neo cassette (ZNF169 Human)
UseCRISPRAvailable SinceDec. 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
pZNF227-donor
Plasmid#112368PurposeCRISPR donor plasmid to tag human transcription factor ZNF227 with GFPDepositorInsertZNF227 homology arms flanking EGFP-IRES-Neo cassette (ZNF227 Human)
UseCRISPRAvailable SinceDec. 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
pOTX1-donor
Plasmid#112364PurposeCRISPR donor plasmid to tag human transcription factor OTX1 with GFPDepositorInsertOTX1 homology arms flanking EGFP-IRES-Neo cassette (OTX1 Human)
UseCRISPRAvailable SinceDec. 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHBP1-donor
Plasmid#112336PurposeCRISPR donor plasmid to tag human transcription factor HBP1 with GFPDepositorInsertHBP1 homology arms flanking EGFP-IRES-Neo cassette (HBP1 Human)
UseCRISPRAvailable SinceNov. 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
LI A-B phrpB
Plasmid#104514PurposeLI promoter moduleDepositorInserthrpB promoter
UseCloning vectorAvailable SinceOct. 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
LI A-B pEPS
Plasmid#104515PurposeLI promoter moduleDepositorInserteps promoter
UseCloning vectorAvailable SinceOct. 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
LI A-B pGala7
Plasmid#104516PurposeLI promoter moduleDepositorInsertGala7 promoter
UseCloning vectorAvailable SinceOct. 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
LI E-F Tfd
Plasmid#104520PurposeLI terminator moduleDepositorInsertTfd terminator
UseCloning vectorAvailable SinceOct. 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
p249_LTJ_1kbFoxp3wtTemplate
Plasmid#82664Purpose1kb HDR template for murine wildtype Foxp3DepositorInsert1kb genomic DNA sequence from murine wildtype Foxp3
UseHdr template for gene editingAvailable SinceFeb. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pPN118
Plasmid#91645PurposeExpress sgRNA targeting human MPP6DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPN119
Plasmid#91646PurposeExpress sgRNA targeting human MPP6DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPN128
Plasmid#91651PurposeExpress sgRNA targeting human PTGISDepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPN129
Plasmid#91652PurposeExpress sgRNA targeting human PTGISDepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only