We narrowed to 6,202 results for: cat.2
-
Plasmid#175318PurposeProduction of HaloTag fusion proteinDepositorInsertIGF2BP2 (IGF2BP2 Human)
UseCell free expressionTagsHaloTag-6xHisExpressionBacterialMutationIsoform BAvailable SinceOct. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLX-SFFV_NKX2-1_Short_V5-GFP
Plasmid#221500PurposeNKX2-1-GFP fusion protein lentiviral overexpression using an SFFV promoterDepositorAvailable SinceJuly 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLX-EF1a_NKX2-1_CdTag-HA
Plasmid#221493PurposeNKX2-1 short isoform lentiviral overexpression of C-terminal dTag fusionDepositorAvailable SinceJuly 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLX-hPGK_NKX2-1_Short_V5-GFP
Plasmid#221498PurposeNKX2-1-GFP fusion protein lentiviral overexpression using an hPGK promoterDepositorAvailable SinceJuly 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCX:γB2ΔICD-EC1-G4S-mTQ2ΔC6
Plasmid#209089PurposemTurquoise2-inserted PcdhgB2 lacking an intracellular domain (ICD)DepositorAvailable SinceDec. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAG306-pTet07-synYFP[TTG/AGA]-4xArg[CGA]-nLuc
Plasmid#199759PurposeElongation reporter construct to quantify elongation duration of 4_CGA stallingDepositorInsertsynYFP[TTG/AGA]-4xArg[CGA]-nLuc
ExpressionYeastPromoterTetO7Available SinceMay 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAG306-pTet07-synYFP[TTG/AGA]-6xArg[CGA]-nLuc
Plasmid#199760PurposeElongation reporter construct to quantify elongation duration of 6_CGA stallingDepositorInsertsynYFP[TTG/AGA]-6xArg[CGA]-nLuc
ExpressionYeastPromoterTetO7Available SinceMay 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAG306-pTet07-synYFP[TTG/AGA]-6xArg[AGA]-nLuc
Plasmid#199761PurposeElongation reporter construct to quantify elongation duration of 6_AGA stallingDepositorInsertsynYFP[TTG/AGA]-6xArg[AGA]-cLuc
ExpressionYeastPromoterTetO7Available SinceMay 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
ZfSp5a-377
Plasmid#192997PurposePlasmid that encodes for Zebrafish Sp5DepositorInsertZebrafish Sp5
TagsHAExpressionMammalianAvailable SinceDec. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
ZfSp5l1
Plasmid#192999PurposePlasmid that encodes for Zebrafish Sp5-likeDepositorInsertZebrafish Sp5-like
TagsHAExpressionMammalianAvailable SinceDec. 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMCL9
Plasmid#176186Purpose2 mu cloning vector for single or multiplexed gRNAs, SNR52p-sfGFP-scRNA-SUP4t-CYC1tDepositorTypeEmpty backboneUseSynthetic BiologyAvailable SinceFeb. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJC8
Plasmid#170757PurposeCo-express in mammalian cells two target proteins C-terminally fused to V5 and FLAG tags respectively, using an internal ribosome entry site and two multi-cloning sites.DepositorTypeEmpty backboneTagssite 1- V5 tag and site 2- FLAG tagExpressionMammalianPromoterCMVAvailable SinceJune 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTR-449 tNGFR-P2A-CCR2
Plasmid#186057PurposeKnockin of truncated NGFR to target geneDepositorAvailable SinceJuly 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMito-MtrxRFP2
Plasmid#172324Purposefluorescent biosensor for the redox of mitochondrial specific thioredoxin (Trx2)DepositorInsertmitochondrial expression of human thioredoxin 2, fused with a redox-sensitive RFP through Gly-Ser-rich linker
TagsHis-tag and Mitochondria localization sequenceExpressionMammalianPromoterCMV, SP6Available SinceAug. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
Cav2.1 HA EI,II,III,IVA (E320A, E670A, E1411A, E1707A) pcDNA3
Plasmid#206121Purposeexpression of rat Cav2.1 calcium channel with a E1686R mutation to enhance expression and a mutation in the P loop of Domains I, II, III and IV to to abolish divalent cation bindingDepositorInsertcacna1a (Cacna1a Rat)
ExpressionMammalianMutationE320A, E670A, E1411A, E1707APromoterCMVAvailable SinceOct. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pB-T-PAF-VLDLR_ecto_short isoform
Plasmid#215395PurposeExpression of the ectodomain(1-797) of the short isoform of the Very Low-Density Lipoprotein Receptor (VLDLR, UniProtKB; P98155-2) fused to a C-tag (EPEA) in th C- terminal for purification.DepositorInsertVLDLR (VLDLR Human)
TagsC-tag (EPEA)ExpressionMammalianMutationp.Ala798_Ala873delPromotertetOAvailable SinceMay 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTet-GLI2shR
Plasmid#136691PurposeInducible Gli2 shRNA lentiviral plasmid (target sequence: human GLI2 5′CCGGCCTGGCATGACTACCACTATGCTCGAGCATAGTGGTAGTCATGCCAGGTTTTTG 3′)DepositorInsertshRNA_humanGli2 (GLI2 Human)
UseLentiviralAvailable SinceJune 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
Circular 200,100 (mIDUA)
Plasmid#170123PurposeAAV vector carrying 2 copies of a guide RNA targeting the mouse IDUA mRNA, expressed from human and mouse U6 promotersDepositorInsertCircular 200,100 guide RNA (Idua Mouse)
UseAAVExpressionMammalianPromoterHuman U6 and mouse U6Available SinceFeb. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEEF1D-FLAG (pcDNA 3.1+) LG6-1
Plasmid#37365DepositorAvailable SinceJuly 17, 2012AvailabilityAcademic Institutions and Nonprofits only -
pFLAG-EEF1D (pcDNA 3.1+) LG3-1
Plasmid#37364DepositorAvailable SinceJuly 17, 2012AvailabilityAcademic Institutions and Nonprofits only