Skip to main content

We narrowed to 14,012 results for: Ung;

Showing: 7411 - 7440 of 14012 results
  1. M-tdTom-ST1

    Plasmid
    #48678
    Purpose
    Mammalian tdTomato activation reporter for ST1 with GTCCCCTCCACCCCACAGTG protospacer
    Depositor
    Insert
    TAL binding site w/ GTCCCCTCCACCCCACAGTG protospacer, ST1-PAM, and tdTomato reporter. Compatible with S. thermophilus #1 Cas9
    Use
    CRISPR
    Promoter
    Sp6
    Available Since
    Oct. 22, 2013
    Availability
    Academic Institutions and Nonprofits only
Showing: 7411 - 7440 of 14012 results