We narrowed to 3,503 results for: cgas
-
Plasmid#209026PurposeLentiviral vector expressing U6 driven hybrid guide (hgRNA) targeting two intergenic sites in the human genome using SpCas9 and AsCas12a nucleases (CHyMErA system), respectivelyDepositorInsertintergenic hgRNA with SpCas9 tracrRNAv1 & AsCas12a DR
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLCHKOv3-intergenic-Lb
Plasmid#209030PurposeLentiviral vector expressing U6 driven hybrid guide (hgRNA) targeting two intergenic sites in the human genome using SpCas9 and LbCas12a nucleases (CHyMErA system), respectivelyDepositorInsertintergenic hgRNA with SpCas9 tracrRNAv1 & LbCas12a DR
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pFlare9A-Clip2E9 Mutant
Plasmid#209575Purposeminigene construct for Clip2 E9 alternative splicing, potential PTBP2 binding sites are deletedDepositorInsertClip2 (Clip2 Mouse)
ExpressionMammalianMutationACGCGTTTCTGAATTCTTCTAACTGCCCTCAAATGCACGGTGGCATGTG…PromoterCMVAvailable SinceMarch 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pQCXIH FRB Ubiqutin-BFP
Plasmid#202426PurposeTagBFP FKBP-rapamycin binding (FRB) dimerization domain fused to ubiquitinDepositorInsertFKBP-rapamycin binding (FRB) dimerization domain
UseLentiviralTagsUbiquitin, TagBFPAvailable SinceJuly 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1 puro shCALM2-1
Plasmid#193699PurposeConstitutive lentiviral expression of CALM2 shRNADepositorInsertCALM2 (CALM2 Human)
UseLentiviralAvailable SinceDec. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLV-GG-hUbC-EBPF2-gRNA-RBMS3
Plasmid#185557PurposeLentiviral backbone with EBFP2 reporter and gRNA targeting RBMS3DepositorInsertRBMS3 gRNAs
UseCRISPR and LentiviralExpressionMammalianAvailable SinceDec. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLV-GG-hUbC-EBPF2-gRNA-HHIP
Plasmid#185551PurposeLentiviral backbone with EBFP2 reporter and gRNA targeting HHIPDepositorInsertHHIP gRNAs
UseCRISPR and LentiviralExpressionMammalianAvailable SinceNov. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLEX304-ARF5-T161A-mNeonGreen
Plasmid#162026PurposeFast cycling ARF mutantDepositorAvailable SinceDec. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
Empty Bridge Control Zfp462-Klf4SE
Plasmid#127666PurposeEncodes for 4 gRNAs expressed from their individual hU6 promoters. Two gRNAs target the Zfp462 promoter while the other two target the Klf4 stretch enhancer.DepositorInsertgRNAs 129, 135, 115, 117
UseCRISPRExpressionMammalianPromoterhU6Available SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHRASLS.2
Plasmid#110324PurposeTRCN0000002620 (Target GCGATAAGTACCGTTGAGTTT), silence human HRASLS gene and express monomeric Kusabira-Orange2DepositorInsertHRASLS (PLAAT1 Human, Homo sapiens)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
CLK3 gRNA (BRDN0001147044)
Plasmid#77284Purpose3rd generation lentiviral gRNA plasmid targeting human CLK3DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
CHKB gRNA (BRDN0001148182)
Plasmid#76866Purpose3rd generation lentiviral gRNA plasmid targeting human CHKBDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
ERBB4 gRNA (BRDN0001146197)
Plasmid#76197Purpose3rd generation lentiviral gRNA plasmid targeting human ERBB4DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
EPHA10 gRNA (BRDN0001146992)
Plasmid#76096Purpose3rd generation lentiviral gRNA plasmid targeting human EPHA10DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
EPHA10 gRNA (BRDN0001146813)
Plasmid#76098Purpose3rd generation lentiviral gRNA plasmid targeting human EPHA10DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
CDKL4 gRNA (BRDN0001149006)
Plasmid#76107Purpose3rd generation lentiviral gRNA plasmid targeting human CDKL4DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
MAP3K6 gRNA (BRDN0001162255)
Plasmid#76012Purpose3rd generation lentiviral gRNA plasmid targeting human MAP3K6DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pTRIP-UbC-Blast-2A-STING-mNeonGreen
Plasmid#227185PurposeLentiviral expression plasmid encoding STING-mNeonGreen under UbC promoterDepositorAvailable SinceJan. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTRIP-hPGK-Blast-2A-STING-TurboID
Plasmid#204713PurposeExpresses C-terminal TurboID tagged human STING for proximity ligation.DepositorAvailable SinceSept. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
PINK1 gRNA (BRDN0001145357)
Plasmid#78036Purpose3rd generation lentiviral gRNA plasmid targeting human PINK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pQCXIZ GFP PODXL delta EC
Plasmid#202423PurposeExpression of GFP-tagged PODXL without extracellular domainDepositorAvailable SinceJuly 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pQCXIZ GFP PODXL 5N>Q
Plasmid#202419PurposeExpression of GFP-tagged PODXL with mutated N-linked glycosylation sitesDepositorAvailable SinceJuly 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pT2/shCol1a1/GFP4_Seq1.3
Plasmid#206136PurposeKnockdown of Collagen Type 1 alpha 1. Construct has inverted repeats to be used in Sleeping Beauty transposon system.DepositorInsertCOL1A1 (Col1a1 Mouse)
ExpressionMammalianAvailable SinceSept. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pQCXIZ GFP PODXL delta IC
Plasmid#202422PurposeExpression of GFP-tagged PODXL without intracellular domainDepositorAvailable SinceJuly 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-ADAR2-2a-Fezf2 sesRNA-2a-tTA2-WPRE
Plasmid#239027PurposeExpression of ADAR2, sesRNA in mammalian cells with hSyn promoter, with tTA2 as efRNA and ADAR2 overexpression.DepositorAvailable SinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-SLC18A1_STOP
Plasmid#161151PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectors. Contains a STOP codon at the end of the codon-optimized ORF sequence.DepositorInsertSLC18A1 (SLC18A1 Human)
ExpressionMammalianAvailable SinceJune 21, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
ULK1 gRNA (BRDN0001145850)
Plasmid#75737Purpose3rd generation lentiviral gRNA plasmid targeting human ULK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pQCXIZ GFP PODXL 4K>R
Plasmid#202420PurposeExpression of ubiquitination-deficient GFP-tagged PODXL (4 cytoplasmic lysines mutated to arginine)DepositorAvailable SinceJuly 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLCHKOv3-mCherry-intergenic-As
Plasmid#209037PurposeLentiviral vector expressing mCherry along with U6 driven hybrid guide (hgRNA) targeting two intergenic sites in the human genome using SpCas9 and AsCas12a nucleases (CHyMErA system), respectivelyDepositorInsertintergenic hgRNA with SpCas9 tracrRNAv1 & AsCas12a DR
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
LADL Bridge + Target Zfp462-Klf4SE
Plasmid#127668PurposeEncodes for CRY2-HA and mCherry proteins expressed from the EF1a promoter; 2 gRNAs targeting the Zfp462 promoter and 2 gRNAs targeting the Klf4 SE expressed from their individual hU6 promotersDepositorInsertCRY2-HA-2A-mCherry and gRNAs 129, 135, 115 and 117
UseCRISPRTagsHAExpressionMammalianPromoterEF1a and hU6Available SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgFat1#1/Cre
Plasmid#173633PurposeExpresses a Fat1-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Fat1 (Fat1 Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable SinceMay 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
MAPK15 gRNA (BRDN0001148491)
Plasmid#75619Purpose3rd generation lentiviral gRNA plasmid targeting human MAPK15DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLenti-gRNA17-1
Plasmid#248545PurposeA CRISPR-based technology to study chromosome-specific aneuploidy by targeting human centromeresDepositorInsertgRNA17-1
UseCRISPRExpressionMammalianPromoterU6Available SinceNov. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_2xsgRNAs_BRF2 (pAVA3258)
Plasmid#239326PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and two sgRNAs targeting BRF2DepositorInsertU6-driven sgRNA1 and 7SK-driven sgRNA2 targeting BRF2 (BRF2 Human)
UseCRISPR and LentiviralAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5/FRT/MALAT1[C8351G] (pAVA3169)
Plasmid#239346PurposeExpresses full-length, driven by its own promoter MALAT1 with stability-compromised ENE(C8351G) and an 11-nt insertion (cgctcgacgta).DepositorInsert10,843 bp of MALAT1 of genomic locus amplified from genomic DNA of Hela cells (MALAT1 Human)
ExpressionMammalianMutationAn 11-nt insertion (cgctcgacgta) and stability-co…Available SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-ClipF-HA-2a-Hu VGAT sesRNA-2a-smV5-2a-tTA2-WPRE
Plasmid#239031PurposeExpression of ClipF, sesRNA in mammalian cells, with smV5 and tTA2 as efRNA.DepositorAvailable SinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR V2 Neo PTEN sgRNA5
Plasmid#233246PurposeKnock out of murine PTENDepositorInsertPTEN (Pten Mouse)
UseLentiviralAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR V2 Neo sgITGA5_5
Plasmid#233253PurposeKnock out of murine ITGA5DepositorInsertITGA5 (Itga5 Mouse)
UseLentiviralAvailable SinceMarch 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR V2 Neo sgITGA5_4
Plasmid#233252PurposeKnock out of murine ITGA5DepositorInsertITGA5 (Itga5 Mouse)
UseLentiviralAvailable SinceMarch 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR V2 Neo sgITGA5_1
Plasmid#233251PurposeKnock out of murine ITGA5DepositorInsertITGA5 (Itga5 Mouse)
UseLentiviralAvailable SinceMarch 19, 2025AvailabilityAcademic Institutions and Nonprofits only