We narrowed to 10,928 results for: cat.1
-
Plasmid#210268PurposeInducible expression of N-terminally EGFP-tagged NIP45 delta-N1 resistant to siRNA. Use with Flp-In T-Rex system.DepositorInsertNIP45 delta-N1 (aa 208-419) siRES (NFATC2IP Synthetic)
TagsEGFPExpressionMammalianMutationdelta-N1, siRESPromoterCMV/TetO2Available SinceDec. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
EGFP-NIP45 delta-N2
Plasmid#210269PurposeInducible expression of N-terminally EGFP-tagged NIP45 delta-N2 resistant to siRNA. Use with Flp-In T-Rex system.DepositorInsertNIP45 delta-N2 (aa 261-419) siRES (NFATC2IP Synthetic)
TagsEGFPExpressionMammalianMutationdelta-N2, siRESPromoterCMV/TetO2Available SinceDec. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
mCherry-NIP45 D394R
Plasmid#210267PurposeInducible expression of N-terminally mCherry-tagged NIP45 D394R resistant to siRNA. Use with Flp-In T-Rex system.DepositorInsertNIP45 D394R siRES (NFATC2IP Synthetic)
TagsmCherryExpressionMammalianMutationD394R, siRESPromoterCMV/TetO2Available SinceDec. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pET-Duet-6xHis-TEV-Nsp8(76-198)
Plasmid#201024PurposeBacterial expression of codon optimized SARS-CoV-2 nsp8 residues 76-198, with an N-terminus His tag followed by a TEV cleavage site.DepositorInsertnon-structural protein 8 (ORF1ab Synthetic, Severe acute respiratory syndrome coronavirus 2)
Tags6xHis-TEVExpressionBacterialMutationGene insert is codon optimized for Ecoli.PromoterT7/LacOAvailable SinceMay 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBridge-tyrosinase.σ3A
Plasmid#197513PurposeExpression of 1) GAL4 DNA-binding domain (BD)-tyrosinase cytosolic tail fusion protein, 2) HA epitope and nuclear localization signal (NLS) AP-3 σ3A fusion protein in yeast (yeast three-hybrid assays)DepositorInsertstyrosinase cytosolic tail
AP-3 σ3A
TagsGAL4-DNA binding domain fragment, HA tag, and nuc…ExpressionYeastMutationsilent substitution in codon 2 of tyrosinase tail…PromoterADH1 and MET25Available SinceMarch 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)-ABL1-gRNA1-exon4
Plasmid#163322PurposeeCas9 ABL1 gRNA 1 (GGGGGACACACCATAGACAG), targeting exon 4 within the protein kinase domain of both ABL1 isoforms 1a and 1b.DepositorInsertABL1 gRNA 1_Exon4
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMAL c2x Tral FL-15A
Plasmid#113011PurposeFor bacterial expression of MBP fusion of full-length Drosophila Tral with phosphomutations (15A)DepositorInsertfull length tral (tral Fly)
ExpressionBacterialMutation15 PNG phosphorylation sites mutated to AAvailable SinceAug. 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMAL c2x Tral C 15A
Plasmid#113007PurposeFor bacterial expression of MBP fusion of C terminal region of Drosophila Tral phosphomutant (15A)DepositorInsertC terminus of tral (tral Fly)
ExpressionBacterialMutationPNG phosphorylation sites mutated to AAvailable SinceAug. 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
PFKM gRNA (BRDN0001146108)
Plasmid#77078Purpose3rd generation lentiviral gRNA plasmid targeting human PFKMDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
SCYL3 gRNA (BRDN0001147728)
Plasmid#76793Purpose3rd generation lentiviral gRNA plasmid targeting human SCYL3DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
ROS1 gRNA (BRDN0001149251)
Plasmid#75991Purpose3rd generation lentiviral gRNA plasmid targeting human ROS1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
ROS1 gRNA (BRDN0001149105)
Plasmid#75992Purpose3rd generation lentiviral gRNA plasmid targeting human ROS1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLPC-NMYC-mTRF1deltaBLM
Plasmid#64163PurposeRetroviral vector expressing mouse TRF1 lacking BLM-binding motifs with N-terminal Myc tagDepositorInsertmTRF1 (Terf1 Mouse)
UseRetroviralTagsMycExpressionMammalianMutationDeleted amino acids 313-316 and 339-342 (both BLM…PromoterCMVAvailable SinceAug. 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
pTn7xTS
Plasmid#117389PurposeTn7 tagging vector with temperature-sensitive origin of replicationDepositorTypeEmpty backboneUseSynthetic BiologyExpressionBacterialAvailable SinceDec. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pET-6xHis-mCherry(-6)-L1
Plasmid#205046PurposeFluorescent protein with charge-patterned cationic peptide to promote biomolecular condensate formation in E. coliDepositorInsertmCherry(-6)-L1
TagsMGHHHHHGGExpressionBacterialAvailable SinceFeb. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET-6xHis-GFP(-6)-L1
Plasmid#205027PurposeFluorescent protein with charge-patterned cationic peptide to promote biomolecular condensate formation in E. coliDepositorInsertGFP(-6)-L1
TagsKGRRGKKSRK and MGHHHHHGGAExpressionBacterialAvailable SinceFeb. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET-6xHis-GFP(-6)-H1
Plasmid#205030PurposeFluorescent protein with charge-patterned cationic peptide to promote biomolecular condensate formation in E. coliDepositorInsertGFP(-6)-H1
TagsKKRRRKK and MGHHHHHGGAExpressionBacterialAvailable SinceFeb. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pmCherryC1 VAP-B KD/MD
Plasmid#226410PurposeExpression of human VAP-B (mutant K87D/M89D, unable to bind FFAT motifs) fused to mCherry in mammalian cellsDepositorInsertVAP-B (VAPB Human)
TagsHA, T7-Xpress tag, and mCherryExpressionMammalianMutationK87D/M89D mutant, unable to bind FFAT motifsAvailable SinceOct. 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKI_ΩBBMVP16&SRDXWUSm1
Plasmid#220349PurposeExpresses BBM-VP16 and SRDX-WUSm1 in plant cellsDepositorTagsSuperman Repression Domain X (SRDX) and VP16 tran…ExpressionPlantMutationtwo amino acid substitution in WUS-box: L255A L25…PromoterCaMV 35S and RPS5AAvailable SinceJuly 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPB-Ins-TRE3Gp-dCas9-Suntag-VP64-EF1Ap-Puro
Plasmid#183409PurposepiggyBAC-based doxycycline-inducible dCas9-5xSuntag-VP64 CRISPR activation plasmid for enhancer and promoter activation in mammalian cellsDepositorInsertdCas9-5xGCN5-P2A-scFV-sfGFP-VP64-GB1
UseCRISPR and Synthetic Biology; PiggybacExpressionMammalianPromoterTRE3GAvailable SinceMay 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPB-Ins-TRE3Gp-KRAB-dCas9-ecDHFR-IRES-GFP-EF1Ap-Puro
Plasmid#183410PurposepiggyBAC-based doxycycline- and trimethoprim-inducible KRAB-dCas9 CRISPR interference plasmid for enhancer and promoter repression in mammalian cellsDepositorInsertKRAB-dCas9-ecDHFR
UseCRISPR and Synthetic Biology; PiggybacExpressionMammalianPromoterTRE3GAvailable SinceMay 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX330_CDC45
Plasmid#244243PurposeExpresses SpCas9 and a sgRNA targeting the human CDC45 loci for knock-in.DepositorAvailable SinceOct. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTet-O-ATOH1-T2A-PuroR
Plasmid#162342PurposeLentiviral expression of ATOH1 under the control of the TetON promoterDepositorAvailable SinceFeb. 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLPC-MYC-hTRF1
Plasmid#64164PurposeRetroviral vector expressing human TRF1 with N-terminal MYC tagDepositorAvailable SinceMay 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
MSCV-IRES-GFP ASXL1 (p.G646 Wfs *12) 3x FLAG
Plasmid#81021PurposeCancer-associated ASXL1 truncation mutant in retroviral vectorDepositorInsertASXL1 (ASXL1 Human)
Tags3X FLAGExpressionMammalianMutationp.G646 Wfs *12 truncationPromoter5’LTRAvailable SinceNov. 17, 2016AvailabilityAcademic Institutions and Nonprofits only -
IL2R/hE-cadherin-cytotail
Plasmid#45773DepositorExpressionMammalianMutationInterleukin-2 receptor α subunit extracellular an…PromoterCMVAvailable SinceJune 28, 2013AvailabilityAcademic Institutions and Nonprofits only -
pCMV6-XL4 ASXL1 (p.G646 Wfs *12) 3x FLAG
Plasmid#74245PurposeCancer-associated ASXL1 truncation mutant in mammalian expression vectorDepositorInsertASXL1 (ASXL1 Human)
Tags3X FLAGExpressionMammalianMutationp.G646 Wfs *12 truncationPromoterCMVAvailable SinceDec. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
psiCHECK-VIM270-gCM
Plasmid#215868PurposeThis plasmid encodes luciferaase which has siRNA binding sites in 3'UTR for detecting the knockdown efficiency of siRNA.DepositorInserttarget site which is completely complementary to guide strand of siRNA for vimentin is inserted to 3'UTR of RLuc (VIM Human)
ExpressionMammalianAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
FUW TetO NET1A-V5 S46A
Plasmid#69829PurposeExpresses NET1A-V5 in mammalian cells in a doxycycline inducible mannerDepositorInsertNeuroepithelial cell-transforming gene 1 protein A (NET1 Human)
UseLentiviralTagsv5ExpressionMammalianMutationS46APromoterminimal CMV promoter with tetracycline operatorAvailable SinceApril 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-MAVS(pLxIS trunc)
Plasmid#221314PurposeExpression of MAVS truncated pLxIS domain in mammalian cells by retroviral transductionDepositorAvailable SinceJuly 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
psiCHECK-VIM270-pCM
Plasmid#215869PurposeThis plasmid encodes luciferaase which has siRNA binding sites in 3'UTR for detecting the knockdown efficiency of siRNA.DepositorInserttarget site which is completely complementary to passanger strand of siRNA for vimentin is inserted to 3'UTR of RLuc (VIM Human)
ExpressionMammalianAvailable SinceMay 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMAL c2x Tral FL-15D
Plasmid#113010PurposeFor bacterial expression of MBP fusion of full-length Drosophila Tral with Phos-mimic mutationsDepositorInsertfull length tral (tral Fly)
ExpressionBacterialMutation15 PNG phosphorylation sites mutated to DAvailable SinceJuly 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
pRS426-TUB1-internal6xHis - human TUBA1a Cterminal tail - C130S, E446C
Plasmid#60394PurposeExpression of chimeric yeast alpha tubulin (TUB1) - internal 6xHis with human alpha tubulin Cterminal tail (TUBA1a) C130S, E446C for crosslinking polyglutamate peptideDepositorInsertTUB1 (TUB1 Synthetic, Budding Yeast)
ExpressionYeastMutationinternal 6xHis (see supplement figure 4), amino a…PromoterGALAvailable SinceJan. 26, 2015AvailabilityAcademic Institutions and Nonprofits only -
FUW TetO HA-AMPKa2 AS
Plasmid#69827PurposeExpresses AMPK alpha 1 in mammalian cells in a doxycycline inducible mannerDepositorInsert5'-AMP-activated protein kinase catalytic subunit alpha-2 (PRKAA2 Human)
UseLentiviralTagsHAExpressionMammalianPromoterminimal CMV promoter with tetracycline operatorAvailable SinceMay 12, 2016AvailabilityAcademic Institutions and Nonprofits only -
FUW TetO HA-AMPKa2 WT
Plasmid#69826PurposeExpresses AMPK alpha 1 in mammalian cells in a doxycycline inducible mannerDepositorInsert5'-AMP-activated protein kinase catalytic subunit alpha-2 (PRKAA2 Human)
UseLentiviralTagsHAExpressionMammalianPromoterminimal CMV promoter with tetracycline operatorAvailable SinceMay 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
Rictor_2 shRNA
Plasmid#1854DepositorAvailable SinceApril 7, 2006AvailabilityAcademic Institutions and Nonprofits only -
pAX1
Plasmid#117397Purposeallelic exchange vector with GFP merodiploid tracker and temperature-sensitive origin of replicationDepositorTypeEmpty backboneUseSynthetic BiologyExpressionBacterialAvailable SinceMarch 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(-)_CMVtrunc_877
Plasmid#105828PurposeA modified pcDNA3.1- vector with reduced expression activity of a truncated CMV promoterDepositorTypeEmpty backboneExpressionMammalianAvailable SinceApril 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMPO 54
Plasmid#69865PurposeExpression vectors for the salycilate cascade expression system (Pnah/NahR-Psal/XylS2).ApR, expression vector with rrnBT1T2-Pm-MCSII, M13 replication originDepositorTypeEmpty backboneExpressionBacterialAvailable SinceDec. 9, 2015AvailabilityAcademic Institutions and Nonprofits only -
pET27b+R
Plasmid#188245PurposeEmpty backbone vector for protein expression in Escherichia coli and his-tag purificationDepositorTypeEmpty backboneTags6xHis tag and TEV siteExpressionBacterialPromoterT7 promoterAvailable SinceOct. 24, 2024AvailabilityAcademic Institutions and Nonprofits only