We narrowed to 11,240 results for: AGA
-
Plasmid#247504PurposeExpresses a synNotch binding to CDH10 (cadherin 10)DepositorInsertsynNotch receptor using a scFvs binding to CDH10 (cadherin 10)
UseLentiviralExpressionMammalianAvailable SinceNov. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHR_PGK_ anti-CSPG5 12959 (VH+VL) synNotch
Plasmid#247514PurposeExpresses a synNotch receptor binding to CSPG5DepositorInsertExpresses a synNotch receptor binding to CSPG5
UseLentiviralExpressionMammalianAvailable SinceNov. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHR_PGK_ anti-PTPRZ CA domain 13058 (VH+VL) synNotch
Plasmid#247518PurposeExpresses a synNotch receptor binding to PTPRZDepositorInsertExpresses a synNotch receptor binding to PTPRZ
UseLentiviralExpressionMammalianAvailable SinceNov. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHR_PGK_ anti-CSPG5 12963 (VH+VL) synNotch
Plasmid#247516PurposeExpresses a synNotch receptor binding to CSPG5DepositorInsertExpresses a synNotch receptor binding to CSPG5
UseLentiviralExpressionMammalianAvailable SinceNov. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHR_PGK_ anti-CSPG5 12963 (VL+VH) synNotch
Plasmid#247515PurposeExpresses a synNotch receptor binding to CSPG5DepositorInsertExpresses a synNotch receptor binding to CSPG5
UseLentiviralExpressionMammalianAvailable SinceNov. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHR_PGK_ anti-PTPRZ CA domain 13059 (VH+VL) synNotch
Plasmid#247520PurposeExpresses a synNotch receptor binding to PTPRZDepositorInsertExpresses a synNotch receptor binding to PTPRZ
UseLentiviralExpressionMammalianAvailable SinceNov. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHR_PGK_ GRM3 13144 VLVH synNotch
Plasmid#247571PurposeExpresses a synNotch receptor binding to GRM3DepositorInsertExpresses a synNotch receptor binding to GRM3
UseLentiviralExpressionMammalianAvailable SinceNov. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHR_PGK_ gb128_ BCAN 13138 VLVH synNotch
Plasmid#247573PurposeExpresses a synNotch receptor binding to BCANDepositorInsertExpresses a synNotch receptor binding to BCAN
UseLentiviralExpressionMammalianAvailable SinceNov. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
SSH-3 WT
Plasmid#245957PurposeExpression of wild-type slingshot 3, a cofilin pSer3 phosphataseDepositorAvailable SinceOct. 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR PARL sg1
Plasmid#244853PurposeKnockout of human PARLDepositorAvailable SinceOct. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBH4-6хHIS-TEV-HP1α
Plasmid#243658PurposeFull-length human HP1α expression vectorDepositorAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLKO-Tet-On-AHR-shRNA3
Plasmid#166909PurposeLentivirus for inducible knockdown of human AHRDepositorAvailable SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKMW493_U6-sgRNA-entry
Plasmid#244823PurposeMammalian expression of SpyCas9 single guide RNA with Golden Gate-compatible sgRNA spacerDepositorInsertSpyCas9 single guide RNA
UseCRISPRExpressionMammalianPromoterU6Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
-
-
-
pAAV-CAG-DIO-ChRmine-ST-P2A-H2B-mRuby3
Plasmid#227779PurposeCation channelrhodopsin ChRmine targeted to the neuronal soma and proximal dendrites in a viral vectorDepositorInsertDIO-ChRmine-ST-P2A-H2B-mRuby3
UseAAVExpressionMammalianAvailable SinceSept. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-5-HT2AR-isoformD
Plasmid#221824PurposePlasmid to express gRNA2 (ctgaagacataattacgtgg) for editing at the end of Drosophila 5-HT2AR isoform D coding frameDepositorInsertd5-HT2AR isoform D gRNA2 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterzebrafish U6 promoter (U6b)Available SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-5-HT2AR-isoformBFH
Plasmid#221825PurposePlasmid to express gRNA1 (cgctatcggtctgtgacaga) for editing at the end of Drosophila 5-HT2AR isoforms B, F and H coding frameDepositorInsertd5-HT2AR isoforms BFH gRNA1 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterzebrafish U6 promoter (U6b)Available SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA-d5-HT7R
Plasmid#221829PurposePlasmid to express gRNA (ggcgagggagagctttctct) for editing at the end of Drosophila 5-HT1AR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only