We narrowed to 5,232 results for: Mos;
-
Plasmid#168468PurposeFor the insertion of NLS-eYFP-H-NSdbd-NLS into the chromosome of a eukaryotic cell line carrying the Flp-IN/T-Rex systemDepositorInsertNLS-eYFP-H-NSdbd-NLS
ExpressionMammalianPromoterCMV promoterAvailable SinceOct. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRD443
Plasmid#168469PurposeFor the insertion pf NLS-mScarlet-I-H-NSdbd-NLS into the chromosome of a eukaryotic cell line carrying the Flp-IN/T-Rex systemDepositorInsertNLS-mScarlet-I-H-NSdbd-NLS
ExpressionMammalianPromoterCMV promoterAvailable SinceOct. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRD444
Plasmid#168470PurposeFor the insertion of NLS-mNeonGreen-H-NSdbd-NLS into the chromosome of a eukaryotic cell line carrying the Flp-IN/T-Rex systemDepositorInsertNLS-mNeonGreen-H-NSdbd-NLS
ExpressionMammalianPromoterCMV promoterAvailable SinceOct. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
-
-
pJET1.2_Bod1l_Sense
Plasmid#124443PurposePlasmid for sense in situ probe in vitro transcriptionDepositorInsertBiorientation of chromosomes in cell division 1-like (Bod1l Mouse)
UseIn situ probePromoterT7Available SinceMay 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-SAP155c
Plasmid#87390PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting SAP155c sequence ATGAAAGACAACTATAGGGC in yeast chromosome 6DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting SAP155c
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS607c
Plasmid#87388PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS607c sequence CTATTTTTGCTTTCTGCACA in yeast chromosome 6.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS607c
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-SAP155b
Plasmid#87389PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting SAP155b sequence GGTTTTCATACTGGGGCCGC in yeast chromosome 6DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting SAP155b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS805a
Plasmid#87393PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS805a sequence TTATTTGAATGATATTTAGT in yeast chromosome 8.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS805a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1206a
Plasmid#87398PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1206a sequence CGAACATTTTTCCATGCGCT in yeast chromosome 12.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1206a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1414a
Plasmid#87400PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1414a sequence GCGCCACAGTTTCAAGGGTC in yeast chromosome 14.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1414a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-RDS1a
Plasmid#87385PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting RDS1a sequence ATTCAATACGAAATGTGTGC in yeast chromosome 3DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting RDS1a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pBI121::smRatioGFP:AQ
Plasmid#240453PurposeExpression of indicator protein fusion (soluble modified ratiometric pHluorin & Aequorin) for monitoring calcium concentrations and pH in the cytoplasm of higher plants. See Resource Information.DepositorInsertFusion of soluble modified ratiometric pHluorin and Aequorin
ExpressionBacterial and PlantMutationRatiometric GFP (ratiometric pHluorin) (PMID 9671…PromoterCauliflower mosaic virus 35S promoter (GenBank AJ…Available SinceSept. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEAT8-137 M1V
Plasmid#173807PurposeExpression and purification of mature (no signal sequence) human alpha1-antitrypsin wildtype variant M1V (UniProt P01009) from E. coli BL21(DE3) cellsDepositorInsertSERPiNA1 (SERPINA1 Human)
ExpressionBacterialMutationE1M Otherwise this plasmid encodes the most commo…PromoterT7Available SinceAug. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBI121::smEclipGFP:AQ
Plasmid#240454PurposeExpression of indicator protein fusion (soluble modified ecliptic pHluorin & Aequorin) for monitoring calcium concentrations and pH in the cytoplasm of higher plants. See Resource Information.DepositorInsertFusion of soluble modified ecliptic pHluorin and Aequorin
ExpressionBacterial and PlantMutationEcliptic GFP (ecliptic pHluorin) (PMID 9671304); …PromoterCauliflower mosaic virus 35S promoter (GenBank AJ…Available SinceSept. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS-PHFF
Plasmid#100280PurposeExpression vector for phycocyanobilin (PCB) synthesis in mammalian cells.DepositorInsertMTS-PcyA-FLAG-P2A-MTS-HA-HO1-P2A-MTS-Myc-Fd-P2A-MTS-Fnr-T7 (synthetic genes)
TagsFLAG, T7 and Mitochondria-targeting sequence (MTS…ExpressionMammalianMutationAll genes are codon-optimized for expression in h…PromoterCAG promoterAvailable SinceSept. 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
pATP416-pluxO5-pphlO6-crtYBI
Plasmid#165977PurposeExpresses carotenoid biosynthesis gene in response to homoserine lactone and 2,4-diacetylphloroglucinol in yeast expressing PhlTA and LuxTADepositorInsertsXanthophyllomyces dendrorhous phytoene-beta carotene synthase (crtYB) mRNA, complete cds
Xanthophyllomyces dendrorhous phytoene desaturase mRNA, complete cds
BTS1 (BTS1 Budding Yeast)
UseSynthetic BiologyExpressionYeastMutationC1281A, G1698A and C66A, C1359TPromoterSynthetic promoter (pluxO5), Synthetic promoter (…Available SinceMarch 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTH733-2µ-RLuc/maxCFLuc
Plasmid#40608DepositorInsertsFirefly Luciferase
Renilla luciferase
ExpressionYeastMutationAll codons of the original FLuc gene were exchang…PromoterADH1 and TDH3Available SinceOct. 30, 2012AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-RDS1a
Plasmid#87405Purposep426_Cas9_gRNA-RDS1a without the ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting RDS1a sequence ATTCAATACGAAATGTGTGC in yeast chromosome 3.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting RDS1a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only