We narrowed to 68,416 results for: TOR;
-
Plasmid#177278Purposegenomic integration of genes (inserted in I-SceI-site) via transposon Tn5DepositorTypeEmpty backboneUseSynthetic Biology; Yeast expression, tn5 genomic …ExpressionBacterialAvailable SinceAug. 6, 2025AvailabilityAcademic Institutions and Nonprofits only
-
MIGR1-U6gRNA2-Filler
Plasmid#237401PurposeFor the sequential insertion of two guide RNAs into two U6gRNA cassettes.DepositorInsertsU6gRNA-1
U6gRNA-2
PGK-TagBFP
UseCRISPR and RetroviralExpressionMammalianPromoterPGK promoter, U6 promoter, and U6, PGKAvailable SinceJune 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pVeBtA3
Plasmid#238988PurposeMammalian expression of bovine arrestin-3 short isoform with Venus N-terminal fusionDepositorAvailable SinceMay 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pVeBtA2-3A
Plasmid#238991PurposeMammalian expression of mutant bovine arrestin-2 long isoform with Venus N-terminal fusionDepositorInsertarrestin-2 long (ARRB2 Bovine)
TagsVenusExpressionMammalianMutationI386A,V387A,F388APromoterCMVAvailable SinceMay 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLJC2-Blast-DHFR-3xFLAG
Plasmid#233892Purposelentiviral overexpression vector for DHFRDepositorAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMXs-mNgn2-x3HA
Plasmid#233189PurposeRetroviral expression of tagged mNgn2x3HADepositorAvailable SinceMarch 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMXs-mNgn2-x3FLAG
Plasmid#233190PurposeRetroviral expression of tagged mNgn2x3FLAGDepositorAvailable SinceMarch 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMXs-mNgn2-x1HA
Plasmid#233191PurposeRetroviral expression of tagged mNgn2x1HADepositorAvailable SinceMarch 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR-v1-sgMTHFD1
Plasmid#217436PurposeLentiviral vector expressing Cas9 and an sgRNA targeting human MTHFD1DepositorInsertsgRNA targeting MTHFD1 (MTHFD1 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJan. 31, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR-v1-sgTYMS
Plasmid#217430PurposeLentiviral vector expressing Cas9 and an sgRNA targeting human TYMSDepositorAvailable SinceJan. 31, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR-v1-sgTK2_4
Plasmid#217431PurposeLentiviral vector expressing Cas9 and an sgRNA targeting human TK2DepositorAvailable SinceJan. 31, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR-v1-sgTK2_5
Plasmid#217432PurposeLentiviral vector expressing Cas9 and an sgRNA targeting human TK2DepositorAvailable SinceJan. 31, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR-v1-sgSHMT2
Plasmid#217435PurposeLentiviral vector expressing Cas9 and an sgRNA targeting human SHMT2DepositorInsertsgRNA targeting SHMT2 (SHMT2 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJan. 31, 2025AvailabilityAcademic Institutions and Nonprofits only -
CAG-mCherry
Plasmid#229135PurposeRetrovirus driving mCherry reporterDepositorInsertmCherry
UseRetroviralExpressionMammalianAvailable SinceJan. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTol1 - 14xUAS:CaSR-EGFP
Plasmid#191502PurposeA UAS construct used to create transgenic fish that express CaSR-EGFP when crossed to a fish carrying a Gal4.DepositorInsertCaSR-EGFP-SV40
UseCreation of transgenic fish using tol1 transgenes…Promoter14X UASAvailable SinceDec. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBK2043-AAV-2xSp1-2xNFkB-EFSNC-dSaCas9
Plasmid#223163Purpose2nd gen. AAV backbone for dSaCas9 (endonuclease dead Cas9 from Staphylococcus aureus) and Sa-gRNA ScaffoldDepositorTypeEmpty backboneUseAAV and CRISPRTags3xFLAGExpressionMammalianMutationEncodes aa 204-310 (MECP2)Available SinceAug. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHDR_NPM2-T2A-mGreenLantern-PuroTK
Plasmid#222910PurposeHomology directed repair template for knocking in mGreenLantern reporter to NPM2.DepositorInsertmGreenLantern
UseCRISPRAvailable SinceJuly 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHDR_FIGLA-T2A-mGreenLantern-PuroTK
Plasmid#222905PurposeHomology directed repair template for knocking in mGreenLantern reporter to FIGLA.DepositorInsertmGreenLantern
UseCRISPRAvailable SinceJuly 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHDR2_TFAP2C-T2A-mGreenLantern-Hygro
Plasmid#222915PurposeHomology directed repair template for knocking in mGreenLantern reporter to TFAP2C.DepositorInsertmGreenLantern
UseCRISPRAvailable SinceJuly 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET41SIII-ATF6(1-373)
Plasmid#171074PurposeExpresses of ATF6α(1-373) in bacteriaDepositorAvailable SinceJuly 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPB-cT3G-cERP2-ZGLP1
Plasmid#222926PurposePiggyBac transposon plasmid for doxycycline inducible expression of ZGLP1DepositorInsertZGLP1 (ZGLP1 Human)
ExpressionMammalianAvailable SinceJuly 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPB-cT3G-cERH-SOHLH1
Plasmid#222922PurposePiggyBac transposon plasmid for doxycycline inducible expression of SOHLH1DepositorInsertSOHLH1 (SOHLH1 Human)
ExpressionMammalianAvailable SinceJuly 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pro::EX1-2(intΔNACs&ΔMYBs):GFP
Plasmid#218572PurposeTranscriptional reporter for ARF7 promoterDepositorInsertAT5G20730 (NPH4 Mustard Weed)
ExpressionPlantMutationMutation genomic sequence 85nt, 86nt from TA to C…Available SinceJuly 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Hbb
Plasmid#99693PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Hbb promoter, vector allows for activation of mouse Hbb, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Hbb (gRNA: GGGGTAAGGGGAGCAAGGTC) (Hbb Mouse, Synthetic)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceMay 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCF702
Plasmid#209650PurposeSuicide plasmid carrying a neomycin resistance marker flanked by homologous regions of the Mth60-fimbria encoding operon of Methanothermobacter thermautotrophicusDepositorInsertsDownstream homologous region
thermostable neomycin phosphotransferase gene
Upstream homologous region
Available SinceMarch 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV_EF1a_DIO_HA/FLAG_muMASS_LF
Plasmid#213394PurposeLoss of function variant of uMASS_1 opioid sensor. AAV virus production for Cre dependent expression.DepositorInsertuMASS_LF
UseAAV and Cre/LoxExpressionMammalianAvailable SinceFeb. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV_hsyn_HA_Flag-uMASS_LF
Plasmid#209761PurposeAAV virus production for neuonal expression of uMASS (loss-of-function) under hSyn promoterDepositorInsertuMASS_LF
UseAAVExpressionMammalianAvailable SinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pS44i8GH-1
Plasmid#207525PurposeConditionally-replicating in Pseudomonas vector, high-copy-number; oriV(pRO1600/ColE1), xylS (cured of BsaI-sites), Pm→repA, P14b with a translational BCD2 coupler from BG35 (53)→msfGFP; SmR/SpRDepositorInsertoriV(pRO1600/ColE1), xylS, Pm→repA, P14b with a translational BCD2 coupler from BG35 (53)→msfGFP;
UseCRISPR; Pseudomonas vectorAvailable SinceDec. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBiFC-VN155(I152L)-SRCR5
Plasmid#207993PurposeBiFC assayDepositorInsertSRCR5 (CD163 pig)
ExpressionMammalianAvailable SinceDec. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hsyn-dMASS_LF_WPRE
Plasmid#209766PurposeAAV virus production for neuronal expression of dMASS_LF (loss-of-function) under hSyn promoterDepositorInsertdMASS_LF
UseAAVExpressionMammalianPromoterhSynAvailable SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV_hsyn_HA-Flag-uMASS_1_WPRE
Plasmid#209760PurposeAAV virus production for neuronal expression of uMASS_1 under hSyn promoterDepositorInsertuMASS_1
UseAAVExpressionMammalianAvailable SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C1-SHTN1S
Plasmid#209561PurposeMammalian expression of Shtn1 short isoformDepositorInsertShtn1 short isoform (4930506M07Rik Mouse)
ExpressionMammalianAvailable SinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
Cav2.2 BBS exon37a pCAGGS
Plasmid#206086Purposeexpression of rabbit Cav2.2 calcium channel with an exofacial double Bungarotoxin Binding Site motif in domain II and alternative exon 37aDepositorAvailable SinceNov. 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLVTHM_mePOU_3xFlag
Plasmid#206395PurposeExpresses 3xflag fused mouse ePOU in mammalian cells, for lentivirus generation.DepositorInsertePOU
UseLentiviralTags3xFLAGExpressionMammalianAvailable SinceOct. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMXS-ATPIF1 E55A
Plasmid#204704Purposeexpresses ATPIF1 E55A in mammalian cellsDepositorAvailable SinceSept. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pKG-GW2
Plasmid#203164PurposeYeast expression vector; To express proteins under control of TDH3 promoter and terminator using methionine selectionDepositorTypeEmpty backboneExpressionYeastAvailable SinceAug. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
pPB-NeoCOVGT3-d2EGFP
Plasmid#201446PurposeFluorescent reporter for genetic tracing of epithelial cell SARS-CoV2 response.DepositorInsertCOVGT3_d2EGFP
UseSynthetic BiologyAvailable SinceJuly 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
pPB-Neo-COVGT1-d2EGFP
Plasmid#201447PurposeFluorescent reporter for genetic tracing of epithelial cell SARS-CoV2 response.DepositorInsertCOVGT1_d2EGFP
UseSynthetic BiologyAvailable SinceJuly 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
pPB-Neo-COVGT2-d2EGFP
Plasmid#201448PurposeFluorescent reporter for genetic tracing of epithelial cell SARS-CoV2 response.DepositorInsertCOVGT2_d2EGFP
UseSynthetic BiologyAvailable SinceJuly 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
pPB-Neo-COVGT4-d2EGFP
Plasmid#201449PurposeFluorescent reporter for genetic tracing of epithelial cell SARS-CoV2 response.DepositorInsertCOVGT4_d2EGFP
UseSynthetic BiologyAvailable SinceJuly 17, 2023AvailabilityAcademic Institutions and Nonprofits only