172,695 results

#156452

Targeting vector to introduce an AID-eGFP cassette at the mouse RAD21 (SCC1) locus using BLASTICIDIN selection. Auxin-inducible degron system. Designed to be used with sgRNA CCACGGTTCCATATTATCTG

Elphege Nora

Liu et al Nat Genet. 2021 Jan;53(1):100-109. doi:

Sept. 2, 2020

Academic Institutions and Nonprofits only

#157686

mammalian expression of N-terminally Flag-His8 tagged SARS-CoV-2 Nsp5 under control of a tetracycline-inducible promoter

David Tollervey

Bresson et al Wellcome Open Res. 2020 Nov 3;5:261. doi

Aug. 5, 2020

Industry, Academic Institutions, and Nonprofits

#136815

Mammalian expression of the centrosomal protein CENPJ N-terminally fused to SNAP-tag

Kai Johnsson

Lukinavicius et al Curr Biol. 2013 Feb 4;23(3):265-70. doi:

March 26, 2020

Academic Institutions and Nonprofits only

#158988

Vector E encodes pAAV-pMecp2-dSaCas9-KRAB-spA-pU6-sgRNA (BsaI) transgenes for AAV packaging and expression of CRISPR interference in neurons

Chung Tin

Lau et al Mol Ther Nucleic Acids. 2019 Jun 7;16:63

Aug. 29, 2020

Academic Institutions and Nonprofits only

#190365

Plasmids encode parts for syntetic genetic circuit construction in eudicot plants (proUBQ10::PIP2A-mCherry-NOSt_pro35S-PhlFO::GFPint-NLS-ADHt)

Jennifer Brophy, Jose Dinneny

Brophy et al Science. 2022 Aug 12;377(6607):747-751.

May 23, 2023

Academic Institutions and Nonprofits only

#44438

William Klein

Mao et al Development. 2013 Feb;140(3):541-51. doi

July 23, 2013

Academic Institutions and Nonprofits only

#190363

Plasmids encode parts for syntetic genetic circuit construction in eudicot plants (proG1090::AmtR-ERF4(RD)-19St)

Jennifer Brophy, Jose Dinneny

Brophy et al Science. 2022 Aug 12;377(6607):747-751.

March 10, 2023

Academic Institutions and Nonprofits only

#190356

Plasmids encode parts for syntetic genetic circuit construction in eudicot plants (proUBQ10::PIP2A-mCherry-NOSt_6XQacRO-min35S::GFPint-ADHt)

Jennifer Brophy, Jose Dinneny

Brophy et al Science. 2022 Aug 12;377(6607):747-751.

March 10, 2023

Academic Institutions and Nonprofits only

#113212

safe haven knock-in plasmid for the act5 locus, C-terminal mScarlet tagging

Rob Kay

Paschke et al PLoS One. 2018 May 30;13(5):e0196809. do

Aug. 6, 2018

Academic Institutions and Nonprofits only

#188520

Backbone for CRISPR interference (CRISPRi) isogenic PAM testing

Isaac Hilton

Escobar et al ACS Synth Biol. 2022 Oct 21;11(10):3239-

Sept. 29, 2022

Academic Institutions and Nonprofits only