We narrowed to 8,093 results for: gnal
-
Plasmid#158247PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsV5.FLAG.VSVgExpressionMutationTruncation of the signaling domainPromoterEF1aAvailable sinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO_NWS.V5.FLAG_NGFR
Plasmid#158251PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsNWS.V5.FLAGExpressionMutationTruncation of the signaling domainPromoterEF1aAvailable sinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pUCIDT-attL1-Worm ABeta-attR5
Plasmid#160437PurposeEntry vector for cloning nematode-codon-optimized Amyloid Beta(1-42) using 2-fragment gateway recombinationDepositorInsertHomo sapiens amyloid beta precursor protein (APP Human, Nematode)
UseTagsCleavage signalExpressionBacterialMutationCodon-optimized for expression in C. elegansPromoterAvailable sinceOct. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO_S.V5.HA_NGFR
Plasmid#158339PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsS.V5.HAExpressionMutationTruncation of the signaling domainPromoterEF1aAvailable sinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMIG-hNFATc2/C(RIT)-FLAG-AVITEV
Plasmid#74053Purposeretroviral expression plasmid for human NFATc2/C (with RIT mutation abrogating AP1 binding) with C-terminal BirA-biotinylation signal and TEV celavage siteDepositorInserthuman NFATc2, isoform C (NFATC2 Human)
UseRetroviralTagsAVI-TEV and FLAGExpressionMammalianMutationsilent mutation A1723C in the sequence of NM_1730…PromoterpMSCV-LTRsAvailable sinceJune 28, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLKO_Ollas.AU1.C_NGFR
Plasmid#158314PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsOllas.AU1.CExpressionMutationTruncation of the signaling domainPromoterEF1aAvailable sinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO_HA.AU1.V5_NGFR
Plasmid#158235PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsHA.AU1.V5ExpressionMutationTruncation of the signaling domainPromoterEF1aAvailable sinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
YFP(1-158)-gamma-2 in pcDNAI/Amp
Plasmid#55762PurposeAn amino-terminal YFP fragment was fused to Ggamma2. When co-expressed with a carboxyl terminal YFP or CFP fragment fused to a Gbeta subunit with which it interacts, a fluorescent signal is produced.DepositorInsertYFP(1-158)-gamma-2 (GNG2 Human, Aequorea victoria)
UseTagsYFP(1-158) was fused to the amino terminus of Gga…ExpressionMammalianMutationYFP (1-158) includes a substitution of Met for Gl…PromoterCMVAvailable sinceJuly 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-AICD-NES-IRES-hrGFP
Plasmid#107544PurposeAAV-mediated expression of AICD (last 50 amino acids of APP) with Nuclear Export Signal (NES: CTCCCTCCACTAGAGCGACTAACCTTA) at C-term end and IRES-mediated co-expression of hrGFPDepositorInsertAICD-NES (APP Human)
UseAAVTagsExpressionMutationNonePromoterCMVAvailable sinceMay 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
Myc-gamma2S/deltaIL
Plasmid#119730PurposeGABAA receptor expression (chimeric rat gamma2 short subunit whose large intracellular loop has been replaced with the large intracellular loop of the rat delta subunit) Myc-tag near N-terminusDepositorUseTagscMyc epitope EQKLISEEDL inserted between fourth a…ExpressionMammalianMutationPromoterAvailable sinceNov. 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDONOR-MARINA
Plasmid#223328PurposeDONOR vector for genomic integration of MARINA voltage sensitive indicator gene from Platisa et al., 2017 (10.1021/acschemneuro.6b00234).DepositorInsertsMARINA
KIR2.1 channel Golgi-to-plasma membrane trafficking signal
UseCRISPR and Synthetic BiologyTagsmCherry and super-ecliptic pHluorinExpressionMammalianMutationPromoterCAGAvailable sinceDec. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
ρ1-EM GABAA receptor in pEZT-BM
Plasmid#213072PurposeExpress human GABA-A rho1 receptor with truncated intracellular domain and superfolder GFP insertion in ICDDepositorInsertHuman GABAa rho1 receptor (GABRR1 Human)
UseBacmam, baculovirus, oocyte expressionTagsTwin-Strep tag and superfolderGFPExpressionMammalianMutationEncodes residues S58–L383 and D451–S479, separate…PromoterCMV and T7Available sinceFeb. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLKO_S.V5.FLAG_NGFR
Plasmid#158337PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsS.V5.FLAGExpressionMutationTruncation of the signaling domainPromoterEF1aAvailable sinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO_S.V5.NWS_NGFR
Plasmid#158338PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsS.V5.NWSExpressionMutationTruncation of the signaling domainPromoterEF1aAvailable sinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO_S.V5.AU1_NGFR
Plasmid#158340PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsS.V5.AU1ExpressionMutationTruncation of the signaling domainPromoterEF1aAvailable sinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO_S.V5.VSVg_NGFR
Plasmid#158341PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsS.V5.VSVgExpressionMutationTruncation of the signaling domainPromoterEF1aAvailable sinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO_Ollas.V5.FLAG_NGFR
Plasmid#158316PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsOllas.V5.FLAGExpressionMutationTruncation of the signaling domainPromoterEF1aAvailable sinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO_Ollas.V5.NWS_NGFR
Plasmid#158317PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsOllas.V5.NWSExpressionMutationTruncation of the signaling domainPromoterEF1aAvailable sinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO_Ollas.V5.HA_NGFR
Plasmid#158318PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsOllas.V5.HAExpressionMutationTruncation of the signaling domainPromoterEF1aAvailable sinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO_Ollas.AU1.V5_NGFR
Plasmid#158319PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsOllas.AU1.V5ExpressionMutationTruncation of the signaling domainPromoterEF1aAvailable sinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO_Ollas.V5.VSVg_NGFR
Plasmid#158320PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsOllas.V5.VSVgExpressionMutationTruncation of the signaling domainPromoterEF1aAvailable sinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO_AU1.Ollas.FLAG_NGFR
Plasmid#158323PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsAU1.Ollas.FLAGExpressionMutationTruncation of the signaling domainPromoterEF1aAvailable sinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO_AU1.Ollas.NWS_NGFR
Plasmid#158326PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsAU1.Ollas.NWSExpressionMutationTruncation of the signaling domainPromoterEF1aAvailable sinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO_AU1.Ollas.HA_NGFR
Plasmid#158328PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsAU1.Ollas.HAExpressionMutationTruncation of the signaling domainPromoterEF1aAvailable sinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO_AU1.Ollas.VSVg_NGFR
Plasmid#158330PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsAU1.Ollas.VSVgExpressionMutationTruncation of the signaling domainPromoterEF1aAvailable sinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO_HSV.AU1.C_NGFR
Plasmid#158286PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsHSV.AU1.CExpressionMutationTruncation of the signaling domainPromoterEF1aAvailable sinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO_HSV.V5.FLAG_NGFR
Plasmid#158288PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsHSV.V5.FLAGExpressionMutationTruncation of the signaling domainPromoterEF1aAvailable sinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO_HSV.V5.NWS_NGFR
Plasmid#158289PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsHSV.V5.NWSExpressionMutationTruncation of the signaling domainPromoterEF1aAvailable sinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO_HSV.V5.HA_NGFR
Plasmid#158290PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsHSV.V5.HAExpressionMutationTruncation of the signaling domainPromoterEF1aAvailable sinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO_HSV.AU1.V5_NGFR
Plasmid#158291PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsHSV.AU1.V5ExpressionMutationTruncation of the signaling domainPromoterEF1aAvailable sinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only