We narrowed to 24,939 results for: SPR
-
Plasmid#216026PurposeFragmid fragment: (Cas protein) firefly luciferaseDepositorHas ServiceCloning Grade DNAInsertFluc_v1.1
UseCRISPR; FragmentAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
AA033
Plasmid#216013PurposeFragmid fragment: (Cas protein) deactivated CasDepositorHas ServiceCloning Grade DNAInsertdCas9-NG_v1.1 [Sp]
UseCRISPR; FragmentAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
AA363
Plasmid#215955PurposeFragmid fragment: (guide cassette) guide expressionDepositorHas ServiceCloning Grade DNAInsertdU6:3_v1; BsmBI_v14; BsmBI_v1; trRNA_v1 [Sp]
UseCRISPR; FragmentAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
AA156
Plasmid#216022PurposeFragmid fragment: (Cas protein) Nanobody binds ALFA tagDepositorHas ServiceCloning Grade DNAInsertNbALFA_v1.1
UseCRISPR; FragmentAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
AA391
Plasmid#216033PurposeFragmid fragment: (Cas protein) reverse TetR; binds to TRE in presence of doxycyclineDepositorHas ServiceCloning Grade DNAInsertrTetR_v1.1
UseCRISPR; FragmentAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
AA303
Plasmid#216071PurposeFragmid fragment: (guide cassette) guide expressionDepositorHas ServiceCloning Grade DNAInsertU6_v1; BsmBI_v0; BsmBI_v6; trRNA_v1 [Nme2]; terminator_v1
UseCRISPR; FragmentAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
AA349
Plasmid#216032PurposeFragmid fragment: (Cas protein) Renilla luciferaseDepositorHas ServiceCloning Grade DNAInsertRluc_v1.1
UseCRISPR; FragmentAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
AA034
Plasmid#216014PurposeFragmid fragment: (Cas protein) deactivated CasDepositorHas ServiceCloning Grade DNAInsertdCas9-SpG_v1.1 [Sp]
UseCRISPR; FragmentAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
AA181
Plasmid#216024PurposeFragmid fragment: (Cas protein) unmodified AsCas12a; not preferredDepositorHas ServiceCloning Grade DNAInsertCas12a_v1.1 [As]
UseCRISPR; FragmentAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
AA022
Plasmid#215930PurposeFragmid fragment: (guide cassette) 2xPP7 & 2xMS2 in trRNADepositorHas ServiceCloning Grade DNAInsertU6_v1; sgCD4_v3 [Sp]; trRNA_v14 [Sp]; CS2
UseCRISPR; FragmentAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
AA016
Plasmid#215927PurposeFragmid fragment: (guide cassette) guide expressionDepositorHas ServiceCloning Grade DNAInsertU6_v1; DR_v0 [EnAs]; BsmBI_v2; BsmBI_v3
UseCRISPR; FragmentAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
AA017
Plasmid#215928PurposeFragmid fragment: (guide cassette) 2xPP7 & 2xMS2 in trRNADepositorHas ServiceCloning Grade DNAInsertU6_v1; BsmBI_v0; BsmBI_v1; trRNA_v14 [Sp]; CS2
UseCRISPR; FragmentAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
AA403
Plasmid#215960PurposeFragmid fragment: (guide cassette) guide expressionDepositorHas ServiceCloning Grade DNAInsertU6_v1; DR_v0 [Cas7-11]; BsmBI_v16; BsmBI_v12
UseCRISPR; FragmentAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
AA151
Plasmid#215938PurposeFragmid fragment: (guide cassette) for dual expression sgRNADepositorHas ServiceCloning Grade DNAInsertU6_v1; BsmBI_v0; BsmBI_v4; rev{H1_v1}
UseCRISPR; FragmentAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
AA400
Plasmid#215958PurposeFragmid fragment: (guide cassette) guide expressionDepositorHas ServiceCloning Grade DNAInsertU6_v1; DR_v1 [Rfx]; BsmBI_v1; BsmBI_v12
UseCRISPR; FragmentAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
AA401
Plasmid#215959PurposeFragmid fragment: (guide cassette) guide expressionDepositorHas ServiceCloning Grade DNAInsertU6_v1; DR_v1 [Dj]; BsmBI_v1; BsmBI_v12
UseCRISPR; FragmentAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
AA048
Plasmid#216016PurposeFragmid fragment: (Cas protein) deactivated CasDepositorHas ServiceCloning Grade DNAInsertdCas12a (D908A)_v1.1 [EnAs]
UseCRISPR; FragmentAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDonor-PRF1-Exon3
Plasmid#209075PurposeTargeting vector for the human PRF1 locus to replace exon 3 with repaired exon 3DepositorInsertPRF1-Exon3 HDRT (PRF1 Human)
UseCRISPRAvailable SinceMarch 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCF827-sgNT-1_U6-sgRNA-EFS-Cas9-P2A-mNeonGreen
Plasmid#211693PurposeU6-sgRNA-EFS-Cas9-P2A-mNeonGreenDepositorInsertSpyCas9 and sgNT-1 guide RNA vector
UseCRISPR and LentiviralExpressionMammalianAvailable SinceFeb. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCF827-sgCIDE-1_U6-sgRNA-EFS-Cas9-P2A-mNeonGreen
Plasmid#211696PurposeU6-sgRNA-EFS-Cas9-P2A-mNeonGreenDepositorInsertSpyCas9 and sgCIDE-1 guide RNA vector
UseCRISPR and LentiviralExpressionMammalianAvailable SinceFeb. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCF827-sgNT-3_U6-sgRNA-EFS-Cas9-P2A-mNeonGreen
Plasmid#211695PurposeU6-sgRNA-EFS-Cas9-P2A-mNeonGreenDepositorInsertSpyCas9 and sgNT-3 guide RNA vector
UseCRISPR and LentiviralExpressionMammalianAvailable SinceFeb. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCF827-sgCIDE-3_U6-sgRNA-EFS-Cas9-P2A-mNeonGreen
Plasmid#211698PurposeU6-sgRNA-EFS-Cas9-P2A-mNeonGreenDepositorInsertSpyCas9 and sgCIDE-3 guide RNA vector
UseCRISPR and LentiviralExpressionMammalianAvailable SinceFeb. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCF827-sgCIDE-2_U6-sgRNA-EFS-Cas9-P2A-mNeonGreen
Plasmid#211697PurposeU6-sgRNA-EFS-Cas9-P2A-mNeonGreenDepositorInsertSpyCas9 and sgCIDE-2 guide RNA vector
UseCRISPR and LentiviralExpressionMammalianAvailable SinceFeb. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCF826-sgNT-1_U6-sgRNA-EFS-Cas9-P2A-mCherry2
Plasmid#211689PurposeU6-sgRNA-EFS-Cas9-P2A-mCherry2DepositorInsertSpyCas9 and sgNT-1 guide RNA vector
UseCRISPR and LentiviralExpressionMammalianAvailable SinceFeb. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCF826-sgCIDE-1_U6-sgRNA-EFS-Cas9-P2A-mCherry2
Plasmid#211690PurposeU6-sgRNA-EFS-Cas9-P2A-mCherry2DepositorInsertSpyCas9 and sgCIDE-1 guide RNA vector
UseCRISPR and LentiviralExpressionMammalianAvailable SinceFeb. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCF826-sgCIDE-2_U6-sgRNA-EFS-Cas9-P2A-mCherry2
Plasmid#211691PurposeU6-sgRNA-EFS-Cas9-P2A-mCherry2DepositorInsertSpyCas9 and sgCIDE-2 guide RNA vector
UseCRISPR and LentiviralExpressionMammalianAvailable SinceFeb. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCF827-sgNT-2_U6-sgRNA-EFS-Cas9-P2A-mNeonGreen
Plasmid#211694PurposeU6-sgRNA-EFS-Cas9-P2A-mNeonGreenDepositorInsertSpyCas9 and sgNT-2 guide RNA vector
UseCRISPR and LentiviralExpressionMammalianAvailable SinceJan. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV.5’eGFP/sgLMNA
Plasmid#170546PurposeExpresses a sgRNA for 5' tagging to LMNA and contains a cassette with eGFP without homology armsDepositorInsertsgRNA targeting 5'- end of LMNA
UseCRISPR and LentiviralAvailable SinceJan. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV.5’eGFP/sgVIM
Plasmid#170548PurposeExpresses a sgRNA for 5' tagging to VIM and contains a cassette with eGFP without homology armsDepositorInsertsgRNA targeting 5'- end of VIM
UseCRISPR and LentiviralPromoterU6Available SinceJan. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pXD71Cas10.6RT4-Pct5.1-crRNA(hcdR)-RT(ΔhcdR)
Plasmid#191646PurposeE. coli - Eggerthella lenta shuttle plasmid (KanR), cumate-inducible promoter Pct5.1-crRNA(hcdR-targeting spacer) hcdR-deleting repair template, used for hcdR deletionDepositorInsertCymR
UseCRISPRExpressionBacterialAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLenti-Sa-gRNA-puro
Plasmid#191652PurposeLentiviral expression of puromycin resistance gene and S. aureus scrambled non-targeting gRNA ; useful for changing gRNA by mutagenesis.DepositorInsertS. aureus gRNAscr
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceNov. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G1G2
Plasmid#188965PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA for bacterial gene knockdownDepositorInsertsdCas9
sgRNA 1: atcggtcgcattgttttccactagg, sgRNA 2: gttagacgctgattacatggactagg
UseSynthetic BiologyExpressionBacterialPromoterPrhaBADAvailable SinceOct. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGEM-T Easy-Cas9-nls-CDS1
Plasmid#160231PurposeCas9-nuclear localization, level 0 of MoClo Golden Gate position CDS1DepositorInsertCas9-nuclear localization signal gene sequence, Golden Gate MoClo position CDS1
UseLevel 0 of moclo golden gate position cds1Available SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEPQD1CB0001
Plasmid#185625PurposeMoClo Level 1, position 2 reverse, transcriptional unit for expression of plant codon optimized Cas9 from Streptococcus pyogenes driven by 35S promoterDepositorInsertSpCas9
UseCRISPR and Synthetic BiologyAvailable SinceAug. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
BPK880-pCAG-DmrC-NLS-3xFLAG-VP64
Plasmid#136912PurposeDmrC with VP64 fused to it's C-terminus; Mammalian expression vectorDepositorInsertpCAG-DmrC-NLS-3xFLAG-VP64
UseCRISPRExpressionMammalianPromoterChicken Beta ActinAvailable SinceJune 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJJGL003
Plasmid#180607PurposePlasmid expressing E. coli codon optimized His-MBP-TEV-DpbCasX+Region3 insertionDepositorInsertDpbCasX with R3 loop
UseCRISPRTags10x His and MBPExpressionBacterialPromoterT7Available SinceApril 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
p23-NES-RanCas13b-msfGFP-NES-Flag
Plasmid#165073Purposeoverexpression of RanCas13b in human cellsDepositorInsertRanCas13b
UseLentiviralExpressionMammalianAvailable SinceSept. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX330_ACTB-e1 sgRNA / hSpCas9
Plasmid#172830PurposeMammalian expression of a sgRNA targeting the exon 2 position 1 of ACTB (Zhong et al, eLife 2021) under the U6 promotor and hSpCas9 under the CAG promotor. This construct is based on pX330.DepositorInsertsgRNA targeting the exon 2 of ACTB under the U6 promotor and hSpCas9 under the CAG promotor
UseCRISPRExpressionMammalianAvailable SinceAug. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX330_ACTB-e2 sgRNA / hSpCas9
Plasmid#172831PurposeMammalian expression of a sgRNA targeting the exon 2 position 2 of ACTB (Zhong et al, eLife 2021) under the U6 promotor and hSpCas9 under the CAG promotor. This construct is based on pX330.DepositorInsertsgRNA targeting the exon 2 of ACTB under the U6 promotor and hSpCas9 under the CAG promotor
UseCRISPRExpressionMammalianAvailable SinceAug. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX330_Camk2a sgRNA / hSpCas9
Plasmid#172839PurposeMammalian expression of a sgRNA targeting the intron 17 (last intron) of Camk2a (Zhong et al, eLife 2021) under the U6 promotor and hSpCas9 under the CAG promotor. This construct is based on pX330.DepositorInsertsgRNA targeting intron 17 of Camk2a under the U6 promotor and hSpCas9 under the CAG promotor
UseCRISPRExpressionMammalianAvailable SinceAug. 25, 2021AvailabilityAcademic Institutions and Nonprofits only