We narrowed to 11,070 results for: AGA
-
Plasmid#171617PurposeAAV Soma-targeted Cal-Light with KA2DepositorInsertTM-KA2-CaM-NES-TevN-AsLOV2-TEVseq-tTA
UseAAV and Synthetic BiologyTagsMycExpressionMammalianPromoterCMVAvailable SinceOct. 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLL3.7 EGFPC2 TAZ
Plasmid#66850PurposeExpress GFP-fused TAZ by lentivirusDepositorAvailable SinceAug. 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCIRCNpu
Plasmid#74226PurposeVector for SICLOPPS-mediated protein circularization using the Nostoc punctiforme DnaE intein.DepositorTypeEmpty backboneUseSynthetic BiologyTagsNpu DnaE C-intein and Npu DnaE N-inteinExpressionBacterialPromoterT7-lacAvailable SinceApril 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMH0006
Plasmid#135448PurposeHuman expression vector containing Ubiquitous Chromatin Opening Element (UCOE) upstream of EF1alpha promoter, dCas9 that is fused to NLS, tagBFP and a KRAB domain.DepositorInsertdCas9-BFP-KRAB
UseLentiviralTagstagBFPExpressionMammalianPromoterEF1AAvailable SinceJuly 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
Fibronectin-human-plasma in pMAX
Plasmid#120401Purposeenables eukaryotic expression of human plasma fibronectinDepositorAvailable SinceJan. 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
pRRL.SIN.EF1A.CD19-FMC63.218.CAR-2G
Plasmid#194457PurposeCAR featuring: GMCSF (sig. peptide); CD8A & CD8A (hinge & TM); 4-1BB & CD3ζ (signaling domains); anti-CD19 from FMC63 in VL-VH order and 218 linker (scFv). GFP-Zeo for selection and monitoring.DepositorInsertAnti-CD19 CAR
UseLentiviralAvailable SinceMarch 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
-
FLAG-HA-FbxO11-pcDNA3.1-
Plasmid#52501Purposeexpresses human FbxO11 in mammalian cells with FLAG-HA tag at N-terminusDepositorAvailable SinceJuly 31, 2015AvailabilityAcademic Institutions and Nonprofits only -
pBABE-puro-Halo-hMRE11(wt)
Plasmid#208393PurposeTo generate stable cell line expressing Halo-human MRE11(WT) by Retroviral infection.DepositorAvailable SinceJan. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLL5.0 mCherry-hCortKD-Flcortmut3YD
Plasmid#187266PurposeLentiviral expression of shRNA targeting Cortactin + reconstitution of Cortactin3YD mutantDepositorInsertCortactin (CTTN Human)
UseLentiviralTagsmCherryMutation3YD (Y412, Y470, Y486)PromoterU6, 5'LTRAvailable SinceSept. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLL5.0 hCortKD-Flcortmut3YF mCherry
Plasmid#187265PurposeLentiviral expression of shRNA targeting Cortactin + reconstitution of Cortactin3YF mutantDepositorInsertCortactin (CTTN Human)
UseLentiviralTagsmCherryMutation3YF (Y412, Y470, Y486)PromoterU6, 5'LTRAvailable SinceSept. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGL4.0-TERT WT
Plasmid#84924Purposeluciferase reporter for TERT promoterDepositorAvailable SinceMarch 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
hZMPSTE24-3FLAG_pQCXIP
Plasmid#89759PurposeHuman ZMPSTE24 mammalian expression vector. Retroviral bicistronic puromycin vector.DepositorInsertHomo sapiens zinc metallopeptidase STE24 (ZMPSTE24) (ZMPSTE24 Human)
UseRetroviral; Bicistronic expression: puromycin re…Tags9bp spacer (NotI site) - 3xFLAG epitopes - Stop c…ExpressionMammalianMutationY253H in ZMPSTE24 (see depositor comments below)PromoterCMVAvailable SinceJune 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCMV-mGold2s-Calnexin-N-14
Plasmid#231768PurposeVisualization of ER in mammalian cells using mGold2sDepositorInsertmGold2s-Calnexin-N-17 (CANX Human)
TagsmGold2sExpressionMammalianMutationI474NPromoterCMVAvailable SinceFeb. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA4-FLAG-Jhdm2a
Plasmid#38136DepositorInsertJhdm2a (Kdm3a Mouse)
TagsFLAGExpressionMammalianMutationprotein starts at aa115PromoterCMVAvailable SinceSept. 28, 2012AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS208a
Plasmid#87383PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS208a sequence GTCCGCTAAACAAAAGATCT in yeast chromosome 2.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS208a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
plentiCRISPR-v2 Puro EIF2AK3/PERK_sgRNA
Plasmid#218666PurposesgRNA targeting human EIF2AK3/PERKDepositorInsertEIF2AK3 (EIF2AK3 Human)
UseCRISPR and LentiviralAvailable SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBK- Ma PylRS WT
Plasmid#197573PurposeExpresses wild-type Methanomethylophilus alvus pyrrolysine tRNA synthetase under GlnS promoter. Used for Pyl tRNA-synthetase selections.DepositorInsertM. alvus PylRS WT
ExpressionBacterialPromoterGlnS (constitutive)Available SinceMarch 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV-mGold2t-Lysosome-N-20
Plasmid#231778PurposeVisualization of lysosome in mammalian cells using mGold2tDepositorAvailable SinceFeb. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
GFP-TRIM33
Plasmid#65398PurposeGFP-tagged BRD protein, which can be used to be expressed in mammalian cells.DepositorAvailable SinceJune 8, 2015AvailabilityAcademic Institutions and Nonprofits only