We narrowed to 24,135 results for: CRISPR
-
Plasmid#91692PurposeMonocot Target-AID vector expressing rice-optimized dCas9-PmCDA1 with sgRNA targeting OsAlsDepositorInsertSpCas9
TagsPmCDA1ExpressionPlantMutationD10A and H840A for dead Cas9Promoter2x35SAvailable SinceJune 6, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMEL16
Plasmid#107922PurposeHIS3 based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y
UseCRISPRExpressionYeastAvailable SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-ABEmax(7.10)-xCas9(3.7)-P2A-EGFP (RTW4644)
Plasmid#140004PurposeCMV and T7 promoter expression plasmid for human codon optimized ABEmax(7.10) A-to-G base editor with xCas9(3.7)(D10A/A262T/R324L/S409I/E480K/E543D/M694I/E1219V) and P2A-EGFPDepositorInserthuman codon optimized ABEmax(7.10) xCas9(3.7) with P2A-EGFP
UseCRISPR; In vitro transcription; t7 promoterTagsP2A-EGFPExpressionMammalianMutationnSpCas9=D10A; xCas9(3.7)=A262T/R324L/S409I/E480K/…PromoterCMV and T7Available SinceMarch 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
UAS-u(S)Cas9
Plasmid#127383PurposeExpresses Cas9 at high levelDepositorInsertuORF(S)-Cas9
UseCRISPRExpressionInsectPromoterUASTAvailable SinceJune 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
TBK1 gRNA (BRDN0001148392)
Plasmid#76362Purpose3rd generation lentiviral gRNA plasmid targeting human TBK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLCKO_LacZ_sgRNA
Plasmid#74179Purposelentiviral vector expressing sgRNA targeting LacZDepositorInsertLacZ sgRNA
UseCRISPR and LentiviralExpressionMammalianPromoterU6 PromoterAvailable SinceMarch 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJZC48
Plasmid#62336PurposesgRNA + 1x COM with COM-VP64 effector for mammalian cellsDepositorInsertssgRNA + 1x COM binding module
COM-VP64
UseLentiviralTagsVP64ExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available SinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
non-targeting control gRNA (BRDN0001146145)
Plasmid#80198Purpose3rd generation lentiviral gRNA plasmid, non-targeting control gRNADepositorInsertNon-targeting control gRNA
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceAug. 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
pROS11
Plasmid#107925PurposeamdS based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y, gRNA-ADE2.Y
UseCRISPRExpressionYeastAvailable SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHelper-T7IS1
Plasmid#140631PurposeExpresses ShCAST under the T7 promoter and an empty sgRNADepositorInsertShTnsB, ShTnsC, ShTniQ, ShCas12k, sgRNA targeting IS1 (Escherichia coli)
UseCRISPR; TransposonExpressionBacterialAvailable SinceJuly 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pRDA_662
Plasmid#216101PurposeCRISPRi, EFS-driven dCas9-KRAB (ZNF10) (Cas only)DepositorInsertCas9 [Sp]
UseCRISPR and Lentiviral; Assembled vectorAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
TBK1 gRNA (BRDN0001145663)
Plasmid#76361Purpose3rd generation lentiviral gRNA plasmid targeting human TBK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
RPS6KA1 gRNA (BRDN0001145974)
Plasmid#75497Purpose3rd generation lentiviral gRNA plasmid targeting human RPS6KA1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSLPB2B-ER50-SpdCas9-tagRFPt-P2A-tagBFP-PGK-Blasticidin
Plasmid#187948PurposeER50 degron-tagged dCas9 fused with tagRFPt, P2A site and tagBFP, expressed under EF1-alpha promoter in a piggyBac plasmid. Expresses Blasticidin resistance under PGK promoter.DepositorInsertER50-SpdCas9-tagRFPt-P2A-tagBFP
UseCRISPR and Synthetic BiologyTagsGGS linkerExpressionMammalianMutation6 mutations, T371A, L384M, M421G, G521R, Y537S, N…Available SinceOct. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJEP305-pAAV-EFS-dSaCas9-KRAB-pA
Plasmid#113681PurposeA EFS driven de-catalyzed SaCas9 fused to KRAB domain for inhibition of transcription in targeted region.DepositorInsertde-catalyzed SaCas9
UseAAV and CRISPRTagsKRAB and NLSAvailable SinceJan. 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMEL10
Plasmid#107916PurposeURA3 based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y
UseCRISPRExpressionYeastAvailable SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
TRIM24 gRNA (BRDN0001146855)
Plasmid#77886Purpose3rd generation lentiviral gRNA plasmid targeting human TRIM24DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSLPB2B-ecDHFR-SpdCas9-tagRFPt-P2A-tagBFP-PGK-Blasticidin
Plasmid#187950PurposeecDHFR degron-tagged dCas9 fused with tagRFPt, P2A site and tagBFP, expressed under EF1-alpha promoter in a piggyBac plasmid. Expresses Blasticidin resistance under PGK promoter.DepositorInsertecDHFR-SpdCas9-tagRFPt-P2A-tagBFP
UseCRISPR and Synthetic BiologyTagsGGS linkerExpressionMammalianAvailable SinceOct. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
TRIM33 gRNA (BRDN0001162242)
Plasmid#77099Purpose3rd generation lentiviral gRNA plasmid targeting human TRIM33DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pNOC_hfnCas12a_NR1_NR2
Plasmid#176252PurposepNOC episomal plasmid harboring the humanized fnCas12a gene sequence tagged with Nlux and CRISPR array with spacers 1 and 2 targeting the Nitrate reductase gene of N. oceanica IMET1 separated by fullDepositorInserthumanized fnCas12a
UseCRISPR, Luciferase, and Synthetic Biology ; Expre…TagsluciferaseAvailable SinceNov. 3, 2021AvailabilityAcademic Institutions and Nonprofits only