We narrowed to 4,936 results for: AAT
-
Plasmid#181738PurposeTransiently expressing a pegRNA to introduce SNCA-A53T mutation in human cellsDepositorInsertPrime editing pegRNA for SNCA-A53T (SNCA Synthetic)
UseCRISPRExpressionMammalianPromoterHuman U6Available SinceSept. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBPK1520-SNCA-A53T-ng
Plasmid#181739PurposeTransiently expressing a nicking sgRNA to facilitate the introduction of SNCA-A53T mutation in PE3 approachDepositorInsertPrime editing ngRNA for SNCA-A53T (SNCA Human)
UseCRISPRExpressionMammalianPromoterHuman U6Available SinceSept. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
TFORF2521
Plasmid#142319PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-SLC1A6_STOP
Plasmid#161152PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectors. Contains a STOP codon at the end of the codon-optimized ORF sequence.DepositorInsertSLC1A6 (SLC1A6 Human)
ExpressionMammalianAvailable SinceJune 21, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pU6-pegRNA-SNCA-A30P
Plasmid#180016PurposeTransiently expressing a pegRNA to introduce SNCA-A30P mutation in human cellsDepositorInsertPrime editing pegRNA for SNCA-A30P (SNCA Synthetic)
UseCRISPRExpressionMammalianPromoterHuman U6Available SinceSept. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
AURKA gRNA (BRDN0001148015)
Plasmid#77726Purpose3rd generation lentiviral gRNA plasmid targeting human AURKADepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
ILK gRNA (BRDN0001147357)
Plasmid#75909Purpose3rd generation lentiviral gRNA plasmid targeting human ILKDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PLL5.0-Anillin ShRNA-Cherry-AnillinA740D, E758K
Plasmid#187273PurposeLentiviral expression of shRNA targeting Anillin + reconstitution of Anillin A740D,E758KDepositorInsertAnillin ,hsAnillin, Entrez Gene ANLN (a.k.a. FSGS8, Scraps, scra) (ANLN Human)
UseLentiviralTagsmCherryMutationAnillin A740D, E758KPromoterU6, CMVAvailable SinceSept. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
KDR gRNA (BRDN0001146648)
Plasmid#77756Purpose3rd generation lentiviral gRNA plasmid targeting human KDRDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
DYRK3 gRNA (BRDN0001145321)
Plasmid#75546Purpose3rd generation lentiviral gRNA plasmid targeting human DYRK3DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
TTK gRNA (BRDN0001147779)
Plasmid#75581Purpose3rd generation lentiviral gRNA plasmid targeting human TTKDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
HCK gRNA (BRDN0001147690)
Plasmid#77213Purpose3rd generation lentiviral gRNA plasmid targeting human HCKDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
MB 103C ttrSR(m13)-Bxb1_P7-sfGFP_mCherry
Plasmid#232475PurposeOptimized tetrathionate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsttrS
ttrR
PttrB185-269
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialPromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceNov. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR IMMP2L sg2
Plasmid#244852PurposeKnockout of human IMMP2LDepositorAvailable SinceOct. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSPcas9(BB)-2A-Puro V2.0 sgCHMP2B-2 aauucccaaaugaagauggc
Plasmid#231998PurposeExpression of an sgRNA targeting CHMP2B, Cas9, and a PuroR markerDepositorAvailable SinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_2xsgRNAs_ZCRB1 (pAVA3300)
Plasmid#239325PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and two sgRNA stargeting ZCRB1DepositorInsertU6-driven sgRNA1 and 7SK-driven sgRNA2 targeting ZCRB1 (ZCRB1 Human)
UseCRISPR and LentiviralAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLCHKOv3-mClover-intergenic_2-As
Plasmid#218814PurposeLentiviral vector expressing mClover3 along with U6 driven hybrid guide (hgRNA) targeting two intergenic sites in the human genome using SpCas9 and AsCas12a nucleases (CHyMErA system), respectivelyDepositorInsertintergenic hgRNA with SpCas9 tracrRNAv1 & AsCas12a DR
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLCHKOv3-mClover-intergenic_3-As
Plasmid#218815PurposeLentiviral vector expressing mClover3 along with U6 driven hybrid guide (hgRNA) targeting two intergenic sites in the human genome using SpCas9 and AsCas12a nucleases (CHyMErA system), respectivelyDepositorInsertintergenic hgRNA with SpCas9 tracrRNAv1 & AsCas12a DR
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLCHKOv3-mClover-intergenic_4-As
Plasmid#218816PurposeLentiviral vector expressing mClover3 along with U6 driven hybrid guide (hgRNA) targeting two intergenic sites in the human genome using SpCas9 and AsCas12a nucleases (CHyMErA system), respectivelyDepositorInsertintergenic hgRNA with SpCas9 tracrRNAv1 & AsCas12a DR
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
PLL5.0-Anillin ShRNA-Cherry-Anillin deltaAnillin homology domain
Plasmid#187277PurposeLentiviral expression of shRNA targeting Anillin + reconstitution of Anillin delta Anillin homology domainDepositorInsertAnillin ,hsAnillin, Entrez Gene ANLN (a.k.a. FSGS8, Scraps, scra) (ANLN Human)
UseLentiviralTagsmCherryMutationdeltaAnillin homology domainPromoterU6, CMVAvailable SinceMay 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
PLL5.0-Anillin ShRNA-GFP-AnillinA740D, E758K
Plasmid#187274PurposeLentiviral expression of shRNA targeting Anillin + reconstitution of Anillin A740D,E758KDepositorInsertAnillin ,hsAnillin, Entrez Gene ANLN (a.k.a. FSGS8, Scraps, scra) (ANLN Human)
UseLentiviralTagsEGFPMutationAnillin A740D, E758KPromoterU6, 5'LTRAvailable SinceSept. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(gKAT6A-A7)-PGKpuro2ABFP-W
Plasmid#159289PurposeLentiviral vector expressing gRNA targeting KAT6A (gRNA ID. A7)DepositorInsertguide RNA targeting KAT6A (ID. A7) (KAT6A Human)
UseCRISPR and LentiviralExpressionMammalianPromoterhuman U6 promoterAvailable SinceOct. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSico shMAP3K2 human
Plasmid#85656Purposeexpression of shRNA targeting human MAP3K2DepositorInsertshRNA targeting 3'UTR of MAP3K2 (MAP3K2 Human)
UseLentiviral and RNAiExpressionMammalianPromoterU6Available SinceJan. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
KALRN gRNA (BRDN0001145005)
Plasmid#77639Purpose3rd generation lentiviral gRNA plasmid targeting human KALRNDepositorAvailable SinceJuly 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
FASTKD3 gRNA (BRDN0001146235)
Plasmid#78064Purpose3rd generation lentiviral gRNA plasmid targeting human FASTKD3DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
FASTKD1 gRNA (BRDN0001147356)
Plasmid#77126Purpose3rd generation lentiviral gRNA plasmid targeting human FASTKD1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
MAP3K5 gRNA (BRDN0001147010)
Plasmid#76653Purpose3rd generation lentiviral gRNA plasmid targeting human MAP3K5DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
AMHR2 gRNA (BRDN0001149245)
Plasmid#76659Purpose3rd generation lentiviral gRNA plasmid targeting human AMHR2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
AK5 gRNA (BRDN0001148177)
Plasmid#76553Purpose3rd generation lentiviral gRNA plasmid targeting human AK5DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
MAPK6 gRNA (BRDN0001149260)
Plasmid#76398Purpose3rd generation lentiviral gRNA plasmid targeting human MAPK6DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
CDKL1 gRNA (BRDN0001148660)
Plasmid#76267Purpose3rd generation lentiviral gRNA plasmid targeting human CDKL1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
LMTK2 gRNA (BRDN0001145198)
Plasmid#76173Purpose3rd generation lentiviral gRNA plasmid targeting human LMTK2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
LMTK2 gRNA (BRDN0001145764)
Plasmid#76174Purpose3rd generation lentiviral gRNA plasmid targeting human LMTK2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
AGK gRNA (BRDN0001146482)
Plasmid#76155Purpose3rd generation lentiviral gRNA plasmid targeting human AGKDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
MAP4K5 gRNA (BRDN0001149337)
Plasmid#75712Purpose3rd generation lentiviral gRNA plasmid targeting human MAP4K5DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
LRRK1 gRNA (BRDN0001148276)
Plasmid#75716Purpose3rd generation lentiviral gRNA plasmid targeting human LRRK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PDGFRA gRNA (BRDN0001145116)
Plasmid#75491Purpose3rd generation lentiviral gRNA plasmid targeting human PDGFRADepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-M-1B6
Plasmid#73430PurposeCRISPR synthetic transcription factor repressor plasmid encoding dCas9, tracrRNA, and a single spacer CRISPR array encoding crRNA for orthogonal repression of T7-lac promoter variant 1B6.DepositorInsertRepressor 1B6 (orthogonal T7-lac repressor)
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterConstitutive wild-type S. pyogenes promoterAvailable SinceApril 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLKO.puro_shGLS
Plasmid#110335PurposeshGLS (Target CAACTGGCCAAATTCAGTC), silence human GLS gene, puromycin selectionDepositorInsertGLS glutaminase (GLS Human, Synthetic)
UseLentiviral and RNAiExpressionMammalianPromoterU6 (RNA PolIII)Available SinceFeb. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLVX-Flag-CDK8-WT-IRES-mCherry
Plasmid#68856PurposeExpresses Human CDK8 Wild-TypeDepositorInsertcyclin-dependent kinase 8 (CDK8 Human)
UseLentiviralTagsFlagExpressionMammalianPromoterEF1αAvailable SinceMarch 11, 2016AvailabilityAcademic Institutions and Nonprofits only