-
Plasmid#73430PurposeCRISPR synthetic transcription factor repressor plasmid encoding dCas9, tracrRNA, and a single spacer CRISPR array encoding crRNA for orthogonal repression of T7-lac promoter variant 1B6.DepositorInsertRepressor 1B6 (orthogonal T7-lac repressor)
UseCRISPR and Synthetic BiologyTagsExpressionBacterialMutationPromoterConstitutive wild-type S. pyogenes promoterAvailable sinceApril 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLenti GW V5 Eco/Dam hum LaminB1
Plasmid#182671PurposeEukaryotic expression vector with E.Coli Dam methylation fused to human Lamin B1. Used in DamID experiments to methylate DNA that interacts in the proximity of Lamin B1.DepositorInsertLamin B1 (LMNB1 Human)
UseLentiviralTagsE. Coli Dam and V5ExpressionMammalianMutationPromoterHSPAvailable sinceApril 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLentiCMVblast_SLC38A2_wt
Plasmid#156180PurposeCMV-driven expression of sgRNA-resistant SLC38A2 wild-type cDNA.DepositorInsertSLC38A2 (SLC38A2 Human)
UseTagsExpressionMammalianMutationSilent mutations to prevent targeting by sgRNA se…PromoterCMVAvailable sinceSept. 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLVX-Flag-CDK19-WT-IRES-ZsGreen
Plasmid#68858PurposeExpresses Human CDK19 Wild-TypeDepositorInsertCyclin-Dependent Kinase 19 (CDK19 Human)
UseLentiviralTagsFlagExpressionMammalianMutationPromoterEF1αAvailable sinceMarch 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-SLC1A5_STOP
Plasmid#161140PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectors. Contains a STOP codon at the end of the codon-optimized ORF sequence.DepositorInsertSLC1A5 (SLC1A5 Human)
UseTagsExpressionMammalianMutationPromoterAvailable sinceJune 21, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pLVX-Flag-CDK8-WT-IRES-mCherry
Plasmid#68856PurposeExpresses Human CDK8 Wild-TypeDepositorInsertcyclin-dependent kinase 8 (CDK8 Human)
UseLentiviralTagsFlagExpressionMammalianMutationPromoterEF1αAvailable sinceMarch 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
COVID-SARS2 NSP14/10
Plasmid#159613PurposeBacterial co-expression vector fo Covid-SARS2 NSP14 and NSP10DepositorInsertsUseTagsHis6, TEV cleavage site and noneExpressionBacterialMutationCodon-optimized for E. coli expressionPromoter(Bicistronic) and T7 - LacOAvailable sinceSept. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLVX-Flag-CDK19-W105M-IRES-ZsGreen
Plasmid#68859PurposeExpresses Human CDK19 W105M MutantDepositorInsertCyclin-Dependent Kinase 19 (CDK19 Human)
UseLentiviralTagsFlagExpressionMammalianMutationW105MPromoterEF1αAvailable sinceMarch 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shB3GNT5.1
Plasmid#110325PurposeTRCN0000034809 (Target GCCTATGTAATCTCCGGTGAT), silence human B3GNT5 gene and express monomeric Kusabira-Orange2DepositorInsertB3GNT5 (B3GNT5 Human)
UseLentiviral and RNAiTagsExpressionMammalianMutationPromoterRNA polymerase III promoter for human U6 snRNA fo…Available sinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLVX-Flag-CDK8-W105M-IRES-mCherry
Plasmid#68857PurposeExpresses Human CDK8 W105M MutantDepositorInsertCyclin-Dependent Kinase 8 (CDK8 Human)
UseLentiviralTagsFlagExpressionMammalianMutationW105MPromoterEF1αAvailable sinceMarch 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
ABL1 gRNA (BRDN0001147582)
Plasmid#77732Purpose3rd generation lentiviral gRNA plasmid targeting human ABL1DepositorInsertABL1 (ABL1 Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pU6-pegRNA-HEK3-CTTins-px330-scaffold
Plasmid#180017PurposeTransiently expressing a pegRNA to introduce HEK3 CTT insertion in human cells. It has a sgRNA scaffold from px330.DepositorInsertPrime editing pegRNA for HEK3-CTTins, with px330 scaffold (EPHA8 Synthetic)
UseCRISPRTagsExpressionMammalianMutationPromoterHuman U6Available sinceSept. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
CHUK gRNA (BRDN0001149372)
Plasmid#77033Purpose3rd generation lentiviral gRNA plasmid targeting human CHUKDepositorInsertCHUK (CHUK Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLKO.puro_shGLS
Plasmid#110335PurposeshGLS (Target CAACTGGCCAAATTCAGTC), silence human GLS gene, puromycin selectionDepositorInsertGLS glutaminase (GLS Human, Synthetic)
UseLentiviral and RNAiTagsExpressionMammalianMutationPromoterU6 (RNA PolIII)Available sinceFeb. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGL3-sgACSL3.C-Cas9-P2A-Puro
Plasmid#129412PurposeEncoding Cas9 and sgACSL3.C for CRISPR/Cas9 mediated HDR tagging of endogenous human ACSL3 C-terminusDepositorInsertSpCas9 and sgACSL3.C (ACSL3 Human)
UseCRISPRTagsP2A-PuroExpressionMammalianMutationPromoterhU6Available sinceAug. 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
AKT3 gRNA (BRDN0001144935)
Plasmid#76218Purpose3rd generation lentiviral gRNA plasmid targeting human AKT3DepositorInsertAKT3 (AKT3 Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceAug. 16, 2016AvailabilityAcademic Institutions and Nonprofits only -
pInducer20_SLC38A2_wt
Plasmid#156182PurposeDox-inducible expression of sgRNA-resistant SLC38A2 wild-type cDNA.DepositorInsertSLC38A2 (SLC38A2 Human)
UseTagsExpressionMammalianMutationSilent mutations to prevent targeting by sgRNA: T…PromoterTREAvailable sinceAug. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMX-mPGK-CD90.2-Rluc_miR
Plasmid#163332PurposeRetroviral vector for negative control of knockdown expressing a non-target miR against Renilla luciferase and expression of a CD90.2 surface marker under control of the murine PGK promoter.DepositorInsertCD90.2 (Thy1 Mouse)
UseRNAi and RetroviralTagsExpressionMammalianMutationPromotermPGKAvailable sinceJan. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shGLS
Plasmid#110319PurposeshGLS (Target CAACTGGCCAAATTCAGTC), silence human GLS gene and express monomeric Kusabira-Orange2DepositorInsertGLS Glutaminase (GLS Human)
UseLentiviral and RNAiTagsExpressionMammalianMutationPromoterRNA polymerase III promoter for human U6 snRNA fo…Available sinceNov. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMY-CD90.2-Rluc_miR
Plasmid#163333PurposeRetroviral vector for negative control of knockdown expressing a non-target miR against Renilla luciferase and expression of a CD90.2 surface marker under control of the LTR promoter.DepositorInsertCD90.2 (Thy1 Mouse)
UseRNAi and RetroviralTagsExpressionMammalianMutationPromoterLTRAvailable sinceJan. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
t206-405
Plasmid#166132PurposeFor expression of human talin-1 head fragment (residues 206-405) in E. coli. N-terminal His6-tag, Xpress-epitope (DLYDDDDK) and enterokinase cleavage site for tag removal.DepositorInsertT1head1-F2F3(206-405) (TLN1 Human)
UseTagsHis6-tag, Xpress-epitope (DLYDDDDK) and enterokin…ExpressionBacterialMutationresidues 206-405 onlyPromoterAvailable sinceApril 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
MDM4_Deletion_Upstream_gRNA_1
Plasmid#195134PurposegRNA in a third generation Cas9 vector with GFP, targeting region immediately upstream of MDM4, to be used with MDM4_Deletion_Downstream_gRNA_1/2 for MDM4 deletionDepositorInsertMDM4 Deletion Upstream gRNA 1 (MDM4 Human)
UseTagsExpressionMammalianMutationPromoterAvailable sinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMXS-IRES-Blast HA-GPAT4-ΔNs5
Plasmid#173169PurposeRetroviral vector to express sgRNA resistant HA tagged human GPAT4 with mutation in CHP1 binding siteDepositorInsertGlycerol-3-Phosphate Acyltransferase 4 (GPAT4 Human)
UseRetroviralTagsHAExpressionMutationSynonymous mutations at sgRNA sites, amino acids …PromoterMMLVAvailable sinceAug. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
t1-405(del30)
Plasmid#166128PurposeExpression of human talin-1 head (residues 1-405) in E. coli. Contains 30 amino acid deletion in F1-loop. N-terminal His6-tag, Xpress-epitope (DLYDDDDK) and enterokinase cleavage site for tag removal.DepositorInsertT1head1-405(del30) (TLN1 Human)
UseTagsHis6-tag, Xpress-epitope (DLYDDDDK) and enterokin…ExpressionBacterialMutationresidues 1-405, with 30 amino acid deletion in th…PromoterAvailable sinceApril 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
t1-405(T144E,T150E)
Plasmid#166130PurposeFor expression of human talin-1 head (residues 1-405) in E. coli. Includes mutations T144E and T150E. N-terminal His6-tag, Xpress-epitope (DLYDDDDK) and enterokinase cleavage site for tag removal.DepositorInsertHuT1head1-405(T144E,T150E) (TLN1 Human)
UseTagsHis6-tag, Xpress-epitope (DLYDDDDK) and enterokin…ExpressionBacterialMutationresidues 1-405, mutations T144E and T150EPromoterAvailable sinceApril 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMY-CD90.2-P2A-BlastDYK-Rluc_miR
Plasmid#163341PurposeRetroviral vector for negative control of knockdown expressing a non-target miR against Renilla luciferase and expression of a Ly6G surface marker and a DYK-tagged Blasticidin selection markerDepositorInsertCD90.2 (Thy1 Mouse)
UseRNAi and RetroviralTagsExpressionMammalianMutationPromoterLTRAvailable sinceJan. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMX-hFTH1-CD90.2-Rluc_miR
Plasmid#163330PurposeRetroviral vector for negative control of knockdown expressing a non-target miR against Renilla luciferase and expression of a CD90.2 surface marker under control of the human FTH1 promoter.DepositorInsertCD90.2 (Thy1 Mouse)
UseRNAi and RetroviralTagsExpressionMammalianMutationPromoterhFTH1Available sinceJan. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMX-hPGK-CD90.2-Rluc_miR
Plasmid#163329PurposeRetroviral vector for negative control of knockdown expressing a non-target miR against Renilla luciferase and expression of a CD90.2 surface marker under control of the human PGK promoter.DepositorInsertCD90.2 (Thy1 Mouse)
UseRNAi and RetroviralTagsExpressionMammalianMutationPromoterhPGKAvailable sinceJan. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
CASK gRNA (BRDN0001145000)
Plasmid#77402Purpose3rd generation lentiviral gRNA plasmid targeting human CASKDepositorInsertCASK (CASK Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
AAV-KrasG12D/sgKras/Cre
Plasmid#99851PurposeExpresses Cre-recombinase, a barcoded HDR template to introduce a G12D mutation into the endogenous Kras locus, and a Kras-targeting sgRNA to enhance HDR.DepositorInsertKras (Kras Mouse)
UseAAV and Cre/LoxTagsExpressionMammalianMutationAvrII site (CAAAGG>CCTAGG), PAM/sgRNA mutation…PromoterAvailable sinceDec. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSLIK_hygro_3xflag_NRF2(RR)
Plasmid#136535PurposeLentiviral expression vector for an inducible 3xflag-tagged NRF2(a1584c_a1586t_a1589g)DepositorInsertNRF2(1584A>C,1586A>T,1589A>G) (NFE2L2 Human)
UseLentiviral; Destinatioin vector for gateway cloni…Tags3x FLAGExpressionMammalianMutationThis plasmid is developed by mutating 3 base pair…PromoterAvailable sinceJuly 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
t1-405(del37/GAG)
Plasmid#166129PurposeExpression of human talin-1 head (aa1-405) in E. coli. Contains 37 amino acid deletion in F1-loop, replaced with Gly-Ala-Gly. N-terminal His6, Xpress-epitopeDLYDDDDK) and enterokinase cleavage site.DepositorInsertT1head1-405(del37/GAG) (TLN1 Human)
UseTagsHis6-tag, Xpress-epitope (DLYDDDDK) and enterokin…ExpressionBacterialMutationaa1-405, with 37 aa deletion in the F1-loop which…PromoterAvailable sinceApril 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEN_TTmiRC2_3xflag_NRF2(RR)
Plasmid#136522PurposeUsed as a donor vector containing N-term 3xFLAG to clone into pSLIKDepositorInsertNRF2(1584A>C,1586A>T,1589A>G) (NFE2L2 Human)
UseEntry vector for gateway cloningTags3x FLAGExpressionMutationThis plasmid is developed by mutating 3 base pair…PromoterAvailable sinceMarch 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
t1-405(151-154AAAA)
Plasmid#166131PurposeExpression of human talin-1 head (aa1-405) in E. coli. Four substitutions in the F1-loop (aa151-154 all mutated to Al). N-terminal His6-tag, Xpress-epitope (DLYDDDDK) and enterokinase cleavage site.DepositorInsertT1head1-405(151-154AAAA) (TLN1 Human)
UseTagsHis6-tag, Xpress-epitope (DLYDDDDK) and enterokin…ExpressionBacterialMutationaa1-405 only. Contains 4 amino acid substitutions…PromoterAvailable sinceApril 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLT3REVIR_MARK3 2573
Plasmid#107233PurposeshRNA 2573. Do not use Evos or Acurri on these cells. Assess by FACS specifically with Venus and DsRed lazers. Tet-ON-all-in-oneDepositorInsertMARK3 shRNA (22 nt) (MARK3 Human)
UseLentiviralTagsExpressionMammalianMutationPromoterAvailable sinceMarch 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
Ac5-STABLE2-RFP-NLS-CycB(1-266)_GFP-E2F1(1-230)_neo
Plasmid#73164Purposemulti-cistronic Vector for expression for Fly_FUCCI probes in insect cellsDepositorUseTagsmRFP1, GFPExpressionInsectMutationCyclin B Fragment aa 1-266 & E2F1 Fragment aa…PromoterAvailable sinceFeb. 12, 2016AvailabilityAcademic Institutions and Nonprofits only -
Lenti-(BB)-hPGK-KRAB-dCas9-P2A-BlastR rs7903146-guide1
Plasmid#125394PurposeCRISPR-mediated repression of human islet enhancer containing T2D-associated variant rs7903146 (TCF7L2 GWAS locus)DepositorInsertKRAB-dCas9-2A-BlastR
UseCRISPR and LentiviralTagsHAExpressionMammalianMutationPromoterhPGK and U6Available sinceJuly 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
PG13-mCherry
Plasmid#195291PurposemCherry reporter containing 13 copies of the p53-binding consensus sequenceDepositorInsertmCherry
UseTagsExpressionMammalianMutationPromoterAvailable sinceFeb. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
PB-TO-hNGN2
Plasmid#172115PurposePiggybac Tet-ON plasmid for differentiating hiPSCs into glutamatergic neurons via NGN2 expressionInsertsUseTagsT2A-mycNLS-mTagBFP2ExpressionMammalianMutationPromoterEF1a and TRE3GAvailable sinceApril 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
PB-PG13-mCherry-EF1a-PuroR-EGFP
Plasmid#195292PurposepiggyBac transposon vector with mCherry reporter containing 13 copies of the p53-binding consensus sequence (constitutive puromycin resistance and EGFP)DepositorInsertsmCherry
PuroR-P2A-EGFP
UsePiggybac transposonTagsExpressionMammalianMutationPromoterAvailable sinceFeb. 10, 2023AvailabilityAcademic Institutions and Nonprofits only