We narrowed to 6,981 results for: Mag

#54784

Localization: C1 Cloning Vector, Excitation: 684, Emission: 708

Michael Davidson, Xiaokun Shu

Yu et al Nat Commun. 2014 May 15;5:3626. doi: 10.

June 20, 2014

Industry, Academic Institutions, and Nonprofits

#136562

F-actin labeling with a near-infrared fluorescent protein miRFP713

Vladislav Verkhusha

Matlashov et al Nat Commun. 2020 Jan 13;11(1):239. doi:

Feb. 12, 2020

Academic Institutions and Nonprofits only

#104309

codes for a fusion of fluorescent protein mGarnet and mito, stains mictochondrial content in live cells, i.e. human cytochrome c oxidase subunit VIII, the mitochondrial targeting sequence mito

Ulrich Nienhaus

Hense et al Sci Rep. 2015 Dec 9;5:18006. doi: 10.103

Oct. 24, 2018

Academic Institutions and Nonprofits only

#43919

Alice Ting

Liu et al PLoS One. 2013;8(2):e52823. doi: 10.1371

March 27, 2013

Academic Institutions and Nonprofits only

#189002

lipophagy-inducing adaptor protein, AAV

Atsushi Hoshino

Minami et al Nat Commun. 2023 Jul 13;14(1):4084. doi:

Sept. 8, 2022

Academic Institutions and Nonprofits only

#85061

In vivo visualization of the cytoplasm, but not the nucleus (can be used for colocalization studies)

Dorus Gadella

Bindels et al Nat Methods. 2016 Nov 21. doi: 10.1038/n

Dec. 6, 2016

Academic Institutions and Nonprofits only

#207093

pX330 based plasmid for expression of Cas9 and the AGCGGGACTCGGCGGCATGG sgRNA to target the DNA-PKcs locus.

Jens Schmidt

Heyza et al Elife. 2023 Jun 21;12:e87086. doi: 10.75

April 30, 2025

Academic Institutions and Nonprofits only

#198199

FRET calibration: Dimer construct consisting of mTurquoise2 and mVenus with a 2A peptide linker for posttranslational linker cleavage

Christian Wahl-Schott

Feldmann et al STAR Protoc. 2023 Jul 28;4(3):102459. do

July 5, 2023

Academic Institutions and Nonprofits only

#205552

Express EPN24-MCP-p6-T2A-eGFP and blasticidin resistance marker

Michael Elowitz

Horns et al Cell. 2023 Jul 10:S0092-8674(23)00689-X.

Sept. 20, 2023

Academic Institutions and Nonprofits only

#84357

Expresses CyRFP1 fluorescent protein in an AAV backbone, FLEX version (Cre dependent)

Ryohei Yasuda

Laviv et al Nat Methods. 2016 Oct 31. doi: 10.1038/n

Nov. 22, 2016

Academic Institutions and Nonprofits only