We narrowed to 5,570 results for: SUP
-
Plasmid#75412PurposeModule for the expression of the Renilla Luciferase with the silencing suppressor P19DepositorInsertRenilla / P19
UseLuciferase and Synthetic BiologyTagsExpressionPlantMutationPromoter35SAvailable sinceAug. 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
pROS13
Plasmid#107927Purposekan based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y, gRNA-ADE2.Y
UseCRISPRTagsExpressionYeastMutationPromoterAvailable sinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pS6-TGFB2-STREP
Plasmid#128503PurposeExpresses human pro-TGFβ2 (from L21 to S414) in mammalian cells. With N-t STREP(2x) tag.DepositorInsertTGFB2 (TGFB2 Human)
UseTagsSTREP (2X) tagExpressionMammalianMutationPromoterCMVAvailable sinceAug. 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
MSCV KSR2 IRES GFP
Plasmid#25969DepositorInsertKinase suppressor of Ras 2 (Ksr2 Mouse)
UseRetroviralTagsFlagExpressionMammalianMutationPromoterAvailable sinceAug. 24, 2010AvailabilityAcademic Institutions and Nonprofits only -
TVBB C-term-Dendra2-Puro
Plasmid#169217PurposeTargeting vector backbone to support a knock-in of Linker-Dendra2-P2A-Puro at the C-terminus of a target locusDepositorInsertDouble SapI flanked Dendra2-P2A-Puro
UseTargeting vector backboneTagsExpressionMutationPromoterAvailable sinceJan. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
Chicken ArcLight S174
Plasmid#53567PurposeGenetically encoded voltage sensor ArcLight with improved kineticsDepositorInsertChicken ArcLight-S174
UseTagsExpressionMammalianMutationGg-VSP contains an R153Q mutation and an amino ac…PromoterCMVAvailable sinceAug. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
Islr2.b-Fc-His
Plasmid#72077PurposeExpresses the extracellular region of the Islr2.b protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorInsertIslr2.b (Islr2 Mouse)
UseTagsFc-HisExpressionMammalianMutationPromoterCMVAvailable sinceFeb. 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
Islr2.b-AP-His
Plasmid#71951PurposeExpresses the extracellular region of the FLRT3 protein, C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorInsertIslr2.b (Islr2 Mouse)
UseTagsAP-HisExpressionMammalianMutationPromoterCMVAvailable sinceJan. 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
Jam4.1-Fc-His
Plasmid#72081PurposeExpresses the extracellular region of the JAM-4, isoform 1 protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorInsertJam4.1 (Igsf5 Mouse)
UseTagsFc-HisExpressionMammalianMutationPromoterCMVAvailable sinceFeb. 12, 2016AvailabilityAcademic Institutions and Nonprofits only -
pET303C-hSOD1 A4V/C6S
Plasmid#139667PurposeExpression plasmids containing human A4V/C6S SOD1DepositorInsertSuperoxide dismutase-1 (SOD1 Human)
UseTagsExpressionBacterialMutationchange alanine 4 to valine, change cysteine 6 to …PromoterT7Available sinceJuly 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pORANGE_Tubb3 GFP(Y39TAG) KI
Plasmid#182678PurposeExpression of spCas9, gRNA targeting the end of Tubb3 gene and donor GFP(Y39TAG). Can be used for amber codon suppression and click chemistry labeling of endogenous beta-3 tubulin in mammalian cells.DepositorUseTagsExpressionMammalianMutationPromoterU6 and chicken beta-actin promoterAvailable sinceMay 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV_SEPT9_i1 S22A S23A-msfGFP
Plasmid#180338Purposemammalian expression of human SEPT9_i1 S22A S23A fused to monomeric superfolder GFPDepositorInsertSEPTIN9_v1 (SEPTIN9 Human)
UseTagsmsfGFPExpressionMammalianMutationSEPT9_i1 S22A S23APromoterCMVAvailable sinceMarch 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV_SEPT9_i1 R10A R15A-msfGFP
Plasmid#180336Purposemammalian expression of human SEPT9_i1 R10A R15A fused to monomeric superfolder GFPDepositorInsertSEPTIN9_v1 (SEPTIN9 Human)
UseTagsmsfGFPExpressionMammalianMutationSEPT9_i1 R10A R15APromoterCMVAvailable sinceMarch 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV_SEPT9_i1 S12A S13A-msfGFP
Plasmid#180337Purposemammalian expression of human SEPT9_i1 S12A S13A fused to monomeric superfolder GFPDepositorInsertSEPTIN9_v1 (SEPTIN9 Human)
UseTagsmsfGFPExpressionMammalianMutationSEPT9_i1 S12A S13APromoterCMVAvailable sinceMarch 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSUMO GLTP
Plasmid#170732PurposeThe plasmids contain inserts (ORFs) for expressing various members of the GlycoLipid Transfer Protein (GLTP) superfamily.DepositorInsertGLTP (GLTP Human)
UseTagsSUMOExpressionBacterialMutationPromoterAvailable sinceJuly 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSB61 - pL0_V2 (CDS1)
Plasmid#123183PurposeGolden Gate (MoClo; CDS1) compatible Tomato yellow leaf curl virus (TYLCV) V2 silencing suppressor based on NCBI Reference Sequence NC_004005DepositorInsertTomato yellow leaf curl virus (TYLCV) V2 (v2 Synthetic)
UsePart for plant expressionTagsExpressionPlantMutationNo BpiI and BsaI sitesPromoterAvailable sinceMay 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHRASLS.2
Plasmid#110324PurposeTRCN0000002620 (Target GCGATAAGTACCGTTGAGTTT), silence human HRASLS gene and express monomeric Kusabira-Orange2DepositorInsertHRASLS (PLAAT1 Human, Homo sapiens)
UseLentiviral and RNAiTagsExpressionMammalianMutationPromoterRNA polymerase III promoter for human U6 snRNA fo…Available sinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHRASLS.1
Plasmid#110323PurposeTRCN0000378630 (Target GATAAGTACCGTTGAGTTTG), silence human HRASLS gene and express monomeric Kusabira-Orange2DepositorInsertHRASLS (PLAAT1 Human, Homo sapiens)
UseLentiviral and RNAiTagsExpressionMammalianMutationPromoterRNA polymerase III promoter for human U6 snRNA fo…Available sinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
Jam4.3-Fc-His
Plasmid#72082PurposeExpresses the extracellular region of the JAM-4, isoform 3 protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorInsertJam4.3 (Igsf5 Mouse)
UseTagsFc-HisExpressionMammalianMutationPromoterCMVAvailable sinceFeb. 12, 2016AvailabilityAcademic Institutions and Nonprofits only -
Jam4.1-AP-His
Plasmid#71955PurposeExpresses the extracellular region of the JAM-4, isoform 1 protein, C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorInsertJam4.1 (Igsf5 Mouse)
UseTagsAP-HisExpressionMammalianMutationPromoterCMVAvailable sinceFeb. 1, 2016AvailabilityAcademic Institutions and Nonprofits only