We narrowed to 18,090 results for: JUN
-
Plasmid#138404PurposeRMCE vector for generating C-terminal Tango fusionDepositorInsertTEVcs(ENLYFQL)-LexAp65
ExpressionInsectAvailable SinceMarch 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
Cas12c-sgRNA_BbsI_CAM
Plasmid#183221PurposeCas12c sgRNA containing BbsI restriction recognition sites in spacer sequence for Golden Gate AssemblyDepositorInsertCas12c single guide RNA containing BbsI sites in spacer sequence
UseCRISPRExpressionBacterialAvailable SinceJune 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGEX6-2 SNAP-Syk tSH2
Plasmid#113028Purposefor purification of Syk tSh2. Purified protein will have a snap tag that can be conjugated to fluorescent dyes.DepositorInsertSNAP-Syk tSH2
TagsSNAPExpressionBacterialAvailable SinceAug. 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
OA-1050E (Ubiq-CasRx)
Plasmid#132416PurposeExpress CasRx under Ubiquitin-63E promoterDepositorInsertCasRx
ExpressionInsectPromoterUbiqAvailable SinceSept. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
Halo-Erk2 donor
Plasmid#113104PurposeDonor plasmid for knock-in HaloTag fusing to the N-terminal of mouse Erk2 coding sequenceDepositorInsertN terminal Erk2 donor region including homology arms and HaloTag
UseSynthetic BiologyAvailable SinceAug. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pFastBac GST-Plk4
Plasmid#80264Purposebaculovirus creation plasmid for GST-Plk4DepositorAvailable SinceJuly 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-EGFP-DmDCP1
Plasmid#21684DepositorAvailable SinceAug. 5, 2009AvailabilityAcademic Institutions and Nonprofits only -
ATM N-terminal sgRNA
Plasmid#207089PurposepX330 based plasmid for expression of Cas9 and the ATCATTAAGTACTAGACTCA sgRNA to target the ATM locus.DepositorInsertATCATTAAGTACTAGACTCA
ExpressionMammalianPromoterCMV and U6Available SinceApril 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAGM24951
Plasmid#169088PurposeMoClo level 0 Tomato E8 promoter moduleDepositorInsertTomato E8 promoter
UseSynthetic Biology; Moclo cloning vectorAvailable SinceNov. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPEE17
Plasmid#128361PurposeDetecting gene essentiality in Cryptococcus neoformans. Targets DNA constructs to the Safe Haven Site 1, a small gene-free region. Contains amdS2 counterselectable marker. This version of the Safe Haven vector includes direct repeats, enabling the formation of popouts on fluoroacetamide.DepositorInsertAcetamidase (amdS)
UseUnspecifiedPromoterTEF1Available SinceJan. 8, 2020AvailabilityAcademic Institutions and Nonprofits only