We narrowed to 3,248 results for: cat.3
-
Plasmid#86321PurposeEncodes gRNA for 3' target of human KDM3ADepositorInsertgRNA against KDM3A (KDM3A Human)
UseCRISPRAvailable SinceJan. 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
PX458_KDM3A_2
Plasmid#86322PurposeEncodes gRNA for 3' target of human KDM3ADepositorInsertgRNA against KDM3A (KDM3A Human)
UseCRISPRAvailable SinceJan. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
PX458_KLF11_2
Plasmid#86315PurposeEncodes gRNA for 3' target of human KLF11DepositorInsertgRNA against KLF11 (KLF11 Human)
UseCRISPRAvailable SinceJan. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPlacPbuCas13b-gRNA-T-deGFP
Plasmid#184840PurposeExpression of a single-spacer CRISPR array with spacer #1 targeting the mRNA of deGFP and expression of PbuCas13b in bacteria.DepositorInsertsingle-spacer CRISPR array with spacer #1 targeting the the mRNA of deGFP, PbuCas13b nuclease
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterJ23119 and lac promoterAvailable SinceOct. 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSCIP-hCD69-TdTomato
Plasmid#154095PurposeSelf-Cutting and Integrating CRISPR backbone targeting human CD69 promoter with TdTomato reporter transgeneDepositorInserts[5HA]-P2A-tdTomato-[3HA]
hCD69 targeting sgRNA - AGCTCTTTGCATCCGGAGAG
UseCRISPRExpressionMammalianAvailable SinceJuly 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pPlacPbuCas13b-gRNA-T-MS2
Plasmid#184839PurposeExpression of a single-spacer CRISPR array with spacer #1 targeting the MS2 phage genome and expression of PbuCas13b in bacteria.DepositorInsertsingle-spacer CRISPR array with spacer #1 targeting the MS2 phage genome, PbuCas13b nuclease
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterJ23119 and lac promoterAvailable SinceOct. 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET28-mTDGa.1
Plasmid#81051Purposebacterial expression of catalytically dead murine TDGDepositorInsertTDG (Tdg Mouse)
Tags6HISExpressionBacterialMutationasparagine 151 changed to alaninePromoterT7Available SinceAug. 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
pTG-mTDGa.1
Plasmid#81049Purposebacterial expression of catalytically dead murine TDGDepositorInsertTDG (Tdg Mouse)
TagsGSTExpressionBacterialMutationasparagine 151 changed to alaninePromoterT7Available SinceSept. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
YCe2741 HC_Kan_EF1ap_p18
Plasmid#100698Purposepart designed to occupy position 18 of EMMA. Functional category: Constitutional promoterDepositorInsertEF1a promoter (EEF1A1 Human)
UseSynthetic BiologyAvailable SinceNov. 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
H3S10ph biosensor
Plasmid#120809PurposeFRET biosensor. To monitor histone H3 Serine 10 phosphorylation in mammalian cells by FRETDepositorInsertMouse histone H3-CFP-FHA2-histone H3 peptide (1-14aa)-YFP
ExpressionMammalianMutationThreonine 3, Threonine 6, and Threonine 11 are mu…PromoterCMVAvailable SinceFeb. 12, 2019AvailabilityAcademic Institutions and Nonprofits only