We narrowed to 5,680 results for: SUP
-
Plasmid#180337Purposemammalian expression of human SEPT9_i1 S12A S13A fused to monomeric superfolder GFPDepositorInsertSEPTIN9_v1 (SEPTIN9 Human)
UseTagsmsfGFPExpressionMammalianMutationSEPT9_i1 S12A S13APromoterCMVAvailable sinceMarch 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSUMO GLTP
Plasmid#170732PurposeThe plasmids contain inserts (ORFs) for expressing various members of the GlycoLipid Transfer Protein (GLTP) superfamily.DepositorInsertGLTP (GLTP Human)
UseTagsSUMOExpressionBacterialMutationPromoterAvailable sinceJuly 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSB61 - pL0_V2 (CDS1)
Plasmid#123183PurposeGolden Gate (MoClo; CDS1) compatible Tomato yellow leaf curl virus (TYLCV) V2 silencing suppressor based on NCBI Reference Sequence NC_004005DepositorInsertTomato yellow leaf curl virus (TYLCV) V2 (v2 Synthetic)
UsePart for plant expressionTagsExpressionPlantMutationNo BpiI and BsaI sitesPromoterAvailable sinceMay 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHRASLS.2
Plasmid#110324PurposeTRCN0000002620 (Target GCGATAAGTACCGTTGAGTTT), silence human HRASLS gene and express monomeric Kusabira-Orange2DepositorInsertHRASLS (PLAAT1 Homo sapiens, Human)
UseLentiviral and RNAiTagsExpressionMammalianMutationPromoterRNA polymerase III promoter for human U6 snRNA fo…Available sinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHRASLS.1
Plasmid#110323PurposeTRCN0000378630 (Target GATAAGTACCGTTGAGTTTG), silence human HRASLS gene and express monomeric Kusabira-Orange2DepositorInsertHRASLS (PLAAT1 Homo sapiens, Human)
UseLentiviral and RNAiTagsExpressionMammalianMutationPromoterRNA polymerase III promoter for human U6 snRNA fo…Available sinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
Jam4.3-Fc-His
Plasmid#72082PurposeExpresses the extracellular region of the JAM-4, isoform 3 protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorInsertJam4.3 (Igsf5 Mouse)
UseTagsFc-HisExpressionMammalianMutationPromoterCMVAvailable sinceFeb. 12, 2016AvailabilityAcademic Institutions and Nonprofits only -
Jam4.1-AP-His
Plasmid#71955PurposeExpresses the extracellular region of the JAM-4, isoform 1 protein, C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorInsertJam4.1 (Igsf5 Mouse)
UseTagsAP-HisExpressionMammalianMutationPromoterCMVAvailable sinceFeb. 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
Jam4.3-AP-His
Plasmid#71956PurposeExpresses the extracellular region of the JAM-4, isoform 3 protein, C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorInsertJam4.3 (Igsf5 Mouse)
UseTagsAP-HisExpressionMammalianMutationPromoterCMVAvailable sinceJan. 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
pRS426-TUB1-internal6xHis - human TUBA1a Cterminal tail - C130S, E446C
Plasmid#60394PurposeExpression of chimeric yeast alpha tubulin (TUB1) - internal 6xHis with human alpha tubulin Cterminal tail (TUBA1a) C130S, E446C for crosslinking polyglutamate peptideDepositorInsertTUB1 (TUB1 Budding Yeast, Synthetic)
UseTagsExpressionYeastMutationinternal 6xHis (see supplement figure 4), amino a…PromoterGALAvailable sinceJan. 26, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCMV_msfGFP-SEPT7
Plasmid#180315Purposemammalian expression of human SEPT7 fused to monomeric superfolder GFPDepositorInsertSEPTIN7 (SEPTIN7 Human)
UseTagsmsfGFPExpressionMammalianMutationPromoterCMVAvailable sinceDec. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pClneoMyc-LATS1
Plasmid#66851PurposeExpress Myc-tagged LATS1 in mammalian cellsDepositorInsertLATS1 (LATS1 Human)
UseTagsMycExpressionMammalianMutationP44L mutation in LATS1 compared to GenBank refere…PromoterCMVAvailable sinceDec. 21, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCMV_SEPT2-msfGFP
Plasmid#180318Purposemammalian expression of human SEPT2 fused to monomeric superfolder GFPDepositorInsertSEPTIN2 (SEPTIN2 Human)
UseTagsmsfGFPExpressionMammalianMutationPromoterCMVAvailable sinceDec. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCK302
Plasmid#87768PurposeAs pCK301 (E. coli rhaBAD promoter upstream of sfGFP, sfGFP can be replaced with any gene of interest), but rhaS cloned downstream of ampR, which allows non-metabolisable inducer L-mannose to be usedDepositorInsertsPrhaBAD-sfGFP
rhaS from E. coli with its native RBS from E. coli
UseSynthetic BiologyTags6xHis TagExpressionBacterialMutationPromoterPrhaBAD rhamnose-inducible promoter from E. coli …Available sinceMay 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)_4x(U6 tRNA M15)_CMV NESPylRS(AF)
Plasmid#182652PurposeEncodes codon-optimized AF mutant of M. mazei pyrrolysine (Pyl) tRNA synthetase fused to a nuclear export signal (NESPylRSAF) & 4x M15 tRNACUA used for amber codon suppression in mammalian cellsDepositorInsertscodon-optimized Y306A/Y384F (AF) double mutant of Methanosarcina mazei-derived pyrrolysine (Pyl) tRNA synthetase
4xU6-tRNAM15
UseTagsnuclear export signal (NES)ExpressionMammalianMutationY306A/Y384F (AF) double mutant of Methanosarcina …PromoterCMV and U6Available sinceMay 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pnEA-vH_His-TEV-SEPT2-msfGFP_SEPT6
Plasmid#174498Purposebacterial co-expression of human SEPT2 fused to monomeric superfolder GFP and of human SEPT6DepositorUseTagsHis6-TEV and msfGFPExpressionBacterialMutationPromoterAvailable sinceSept. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ucp1-Cre-miR122
Plasmid#228408PurposeExpression of Cre recombinase from a rat Ucp1 enhancer-promoter. Contains miR122 target sequences that suppress expression in hepatocytes.DepositorInsertscre recombinase with SV40 NLS
Cre recombinase with SV40 NLS
UseAAVTagsExpressionMutationPromoterrat Ucp1 enhancer-promoterAvailable sinceJan. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
Tet-pLKO-puro shKRAS
Plasmid#116871PurposeTet-inducible suppression of KRASDepositorInsertshKRAS (KRAS Human)
UseLentiviral and RNAiTagsExpressionMammalianMutationPromoterH1/TOAvailable sinceSept. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCMVtrunc sfCherry2ΔC4-Lifeact
Plasmid#231557PurposeMammalian expression of Lifeact fused to C-terminally truncated superfolder Cherry2, for actin filament organization measurements using fluorescence polarization microscopyDepositorInsertLifeact (ABP140 Budding Yeast)
UseTagssfCherry2ExpressionMammalianMutationPromoterCMVtruncAvailable sinceJan. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-sACE2v2.4-sfGFP
Plasmid#149666PurposeMammalian expression plasmid for sACE2-sfGFP high affinity variant 2.4DepositorInsertAngiotensin-converting enzyme 2 (ACE2 Human)
UseTagsLinker GSGGSGSGG and superfolder GFPExpressionMammalianMutationExtracellular, soluble protease domain (a.a. M1-D…PromoterCMVAvailable sinceMay 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-sACE2v2-sfGFP
Plasmid#145173PurposeMammalian expression plasmid for sACE2-sfGFP high affinity variant 2DepositorInsertAngiotensin-converting enzyme 2 (ACE2 Human)
UseTagsLinker GSGGSGSGG and superfolder GFPExpressionMammalianMutationExtracellular, soluble protease domain (a.a. M1-D…PromoterCMVAvailable sinceApril 15, 2020AvailabilityAcademic Institutions and Nonprofits only