We narrowed to 5,977 results for: crispr cas9 expression plasmids
-
Plasmid#121119PurposeEndogenous gene activation with the SunTag CRISPR activation systemDepositorInsertdCas9-GCN4x10_scFv-VP64
UseCRISPRExpressionMammalianPromoterTet-ONAvailable SinceMay 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAT15489_dABE8e
Plasmid#174127Purposeplasmid expressing ABE8e with dCas9DepositorInsertdABE8e
UseCRISPRTagsNucleoplasmin NLS and SV40 NLSExpressionMammalianPromoterEF1-aAvailable SinceNov. 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAT9749-dABE
Plasmid#162998Purposeplasmid expressing ABE with dCas9DepositorInsertdABE
UseCRISPRTags3xFLAG and SV40 NLSExpressionMammalianPromoterEF1-aAvailable SinceSept. 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-iPE-Plus
Plasmid#214062Purposeinducible PE-Plus system for controllable prime editing; this plasmid is used to insert PE-Plus prime editor (PEmax-P2A-hP53DD-IRES-MLH1dn) in one allele of AAVS1 locusDepositorInsertPE-Plus
ExpressionMammalianPromoterTRE-tightAvailable SinceJune 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
P530_SIX6-p2A-h2b-EGFP
Plasmid#239101PurposeHuman donor plasmid for integration of p2A-h2b-EGFP into the 3' end of SIX6. This includes the donor casette and a U6 driven guide sequence to be used with Cas9.DepositorInsertSIX6 (SIX6 Human)
UseDonor plasmidTagsp2A-h2b-EGFPExpressionMammalianPromoterEndogenous SIX6 promoterAvailable SinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
MKC89_CCR5(UbC-tEPOR-2A-YFP)
Plasmid#232404PurposeAAV production plasmid for UbC-tEPOR-2A-YFP vector from Fig. 2 that mediates HDR at CCR5 locus using CCR5-sg3 gRNA. YFP is followed by a BGH polyA. AAV genome is flanked by AAV2 ITRs.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
MKC91_tEPOR(UbC-GFP-BGH)
Plasmid#232406PurposeAAV production plasmid for tEPOR-UbC-GFP-BGH vector from Fig. 1 that mediates HDR at EPOR locus using EPOR-sg1 gRNA. Repair vector introduces premature stop codon into EPOR locus.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX3
Plasmid#183904Purposedonor plasmid for CRISPR Cas9 knockin near the Aedes aegypti m / M locusDepositorInsertGFP
ExpressionInsectPromoterAedes aegypti PolyubiquitinAvailable SinceAug. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
sgRNA Clec12a (CT6)
Plasmid#236203Purposelentiviral expression of Cas9 and encodes CT6 sgRNA for CLEC12A deletionDepositorAvailable SinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
sgRNA Clec12a (CT44)
Plasmid#236204Purposelentiviral expression of Cas9 and encodes CT44 sgRNA for CLEC12A deletionDepositorAvailable SinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
sgRNA Clec12a (CT47)
Plasmid#236205Purposelentiviral expression of Cas9 and encodes CT47 sgRNA for CLEC12A deletionDepositorAvailable SinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDNR-gRNA
Plasmid#206990PurposeA plasmid for expression of SaCas9-sgRNA targeting donor plasmidsDepositorInsertDonor plasmid-targeting SaCas9-gRNA
ExpressionMammalianPromoterU6Available SinceApril 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSLQ1651-sgRNA(F+E)-sgGal4
Plasmid#100549PurposesgGal4-expressing vector modified from Addgene plasmid #51024DepositorInsertsgGal4
UseCRISPRTagssgRNAExpressionMammalianPromoterU6Available SinceSept. 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMM765
Plasmid#133602PurposePart Plasmid for dCas9 NLS Stop, Part 3(coding sequence)DepositorInsertdCas9 NLS Stop
UseSynthetic BiologyAvailable SinceDec. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMM766
Plasmid#133603PurposePart Plasmid for dCas9 NLS Stop, Part 3b(coding sequence)DepositorInsertdCas9 NLS Stop
UseSynthetic BiologyAvailable SinceDec. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDonor MAFA-P2A-tdTomato
Plasmid#246654PurposeDonor plasmid for Crispr/Cas9 gene editing of the human MAFA locusDepositorInsertP2A-tdTomato flanked by MAFA homology regions (MAFA Synthetic, Human)
UseCRISPRExpressionMammalianAvailable SinceJan. 26, 2026AvailabilityAcademic Institutions and Nonprofits only -
pDonor AVIL-P2A-iCre
Plasmid#246652PurposeDonor plasmid for Crispr/Cas9 gene editing of the human AVIL locusDepositorInsertP2A-iCre flanked by AVIL homology regions (AVIL Synthetic, Human)
UseCRISPRExpressionMammalianAvailable SinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FLEXfrt-EGFP-KASH
Plasmid#154374PurposeVector for Flp-dependent expression of EGFP tagged KASH protein domainDepositorInsertEGFP-KASH
UseAAVExpressionMammalianAvailable SinceAug. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
53BP1 N-terminal sgRNA
Plasmid#207091PurposepX330 based plasmid for expression of Cas9 and the GGGGAGCAGATGGACCCTAC sgRNA to target the 53BP1 locus.DepositorInsertGGGGAGCAGATGGACCCTAC
ExpressionMammalianPromoterCMV and U6Available SinceMarch 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
RIF C-terminal sgRNA
Plasmid#207096PurposepX330 based plasmid for expression of Cas9 and the AATACTAAATAGAATTTTCA sgRNA to target the RIF1 locus.DepositorInsertAATACTAAATAGAATTTTCA
ExpressionMammalianPromoterCMV and U6Available SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only