We narrowed to 24,940 results for: SPR
-
Plasmid#178227PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsAU1.NWS.Ollas and Nuclear Localization SignalPromotereF1aAvailable SinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_AU1.HSV.V5_mCherry-NLS
Plasmid#178226PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsAU1.HSV.V5 and Nuclear Localization SignalPromotereF1aAvailable SinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_AU1.HSV.NWS_mCherry-NLS
Plasmid#178222PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsAU1.HSV.NWS and Nuclear Localization SignalPromotereF1aAvailable SinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_AU1.HA.NWS_mCherry-NLS
Plasmid#178217PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsAU1.HA.NWS and Nuclear Localization SignalPromotereF1aAvailable SinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pNOC_dCas9_sgRNA Td1
Plasmid#176257PurposepNOC episomal plasmid harboring the dead version of humanized spCas9 gene sequence tagged with Nlux and sgRNA targeting the fluorescent gene tdtomato with spacer 1DepositorInsertdead spCas9
UseCRISPR, Luciferase, and Synthetic Biology ; Expre…TagsluciferaseAvailable SinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNOC_hfnCas12a-Nlux_crRNA NR2
Plasmid#176245PurposepNOC episomal plasmid harboring the humanized fnCas12a gene sequence tagged with Nlux and crRNA targeting the Nitrate reductase gene of N. oceanica IMET1 with spacer 2DepositorInserthumanized fnCas12a
UseCRISPR, Luciferase, and Synthetic Biology ; Expre…TagsluciferaseAvailable SinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNOC_hfnCas12a_crRNA NR2
Plasmid#176248PurposepNOC episomal plasmid harboring the humanized fnCas12a gene sequence without Nlux tag and crRNA targeting the Nitrate reductase gene of N. oceanica IMET1 with spacer 2DepositorInserthumanized fnCas12a
UseCRISPR and Synthetic Biology; Expression in micro…Available SinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNOC_hfnCas12a_crRNA NR1
Plasmid#176247PurposepNOC episomal plasmid harboring the humanized fnCas12a gene sequence without Nlux tag and crRNA targeting the Nitrate reductase gene of N. oceanica IMET1 with spacer 1DepositorInserthumanized fnCas12a
UseCRISPR and Synthetic Biology; Expression in micro…Available SinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNOC_hfnCas12a-Nlux_crRNA NR3
Plasmid#176246PurposepNOC episomal plasmid harboring the humanized fnCas12a gene sequence tagged with Nlux and crRNA targeting the Nitrate reductase gene of N. oceanica IMET1 with spacer 3DepositorInserthumanized fnCas12a
UseCRISPR, Luciferase, and Synthetic Biology ; Expre…TagsluciferaseAvailable SinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNOC_hfnCas12a_crRNA NR3
Plasmid#176249PurposepNOC episomal plasmid harboring the humanized fnCas12a gene sequence without Nlux tag and crRNA targeting the Nitrate reductase gene of N. oceanica IMET1 with spacer 3DepositorInserthumanized fnCas12a
UseCRISPR and Synthetic Biology; Expression in micro…Available SinceNov. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
pUFlip-floxed2A-KalTA4-; gcry1:BFP -2
Plasmid#173891PurposeDonor for generating conditional alleles in zebrafish using precise CRISPR directed genomic integration with the GeneWeld methodDepositorInsert2A-KalTA4; gcry1: BFP
UseSynthetic BiologyAvailable SinceAug. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pKLV-gRNA-Bcan-Ntrk1_4
Plasmid#136413PurposeLentiviral expression of gRNAs targeting intron 13 of murine Bcan and intron 10 of murine Ntrk1. Also constitutively expresses Puromycin linked to TagBFP.DepositorInsertU6_sgRNA(Bcan)_U6_sgRNA(Ntrk1)
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pKLV-gRNA-Myb-Qk_1
Plasmid#136415PurposeLentiviral expression of gRNAs targeting intron 4 of murine Qk and intron 9 of murine Myb. Also constitutively expresses Puromycin linked to TagBFP.DepositorInsertU6_sgRNA(Myb)_U6_sgRNA(Qk)
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
-
-
-
-
-
-
gh130
Plasmid#106800Purposeexpression of gRNA targeting CSGALNACT2DepositorInsertCSGALNACT2 (CSGALNACT2 Human)
ExpressionMammalianAvailable SinceNov. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
-
-
-
-
-
-
pJSC115 - Bacterial expression plasmid for SpCas9-HF1, HNH FRET variant
Plasmid#101210PurposeBacterial expression plasmid for SpCas9-HF1, HNH FRET variantDepositorInsertSpCas9 variant C80S/C574S/S355C/S867C/N497A/R661A/Q695A/Q926A
Tags10x His, MBP, and TEV siteExpressionBacterialMutationC80S, C574S, S355C, S867C, N497A, R661A, Q695A an…PromoterT7Available SinceNov. 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJSC038 - Bacterial expression plasmid for SpCas9∆REC3, HNH FRET variant
Plasmid#101203PurposeBacterial expression plasmid for SpCas9∆REC3, HNH FRET variantDepositorInsertSpCas9 variant C80S/C574S/S355C/S867C/M1–N497,GGS,V713–D1368
Tags10x His, MBP, and TEV siteExpressionBacterialMutationC80S, C574S, S355C, S867C, M1-N497, GGS, V713-D13…PromoterT7Available SinceOct. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJSC131 - Bacterial expression plasmid for SpCas9-HF1, REC3 FRET variant
Plasmid#101212PurposeBacterial expression plasmid for SpCas9-HF1, REC3 FRET variantDepositorInsertSpCas9 variant C80S/C574S/S701C/S960C/N497A/R661A/Q695A/Q926A
Tags10x His, MBP, and TEV siteExpressionBacterialMutationC80S, C574S, S701C, S960C, N497A, R661A, Q695A an…PromoterT7Available SinceOct. 23, 2017AvailabilityAcademic Institutions and Nonprofits only -
BPK4393 - human expression plasmid for SpCas9 Cluster 5 + Q926A
Plasmid#101192PurposeHuman expression plasmid for SpCas9 Cluster 5 + Q926A variant: CMV-T7-hSpCas9-Cluster5+Q926A(K918A, V922A, R925A, Q926A)-NLS(SV40)-3xFLAGDepositorInserthSpCas9-Cluster5+Q926A(K918A/V922A/R925A/Q926A)
Tags3x FLAG and NLS (SV40)ExpressionMammalianMutationK918A/V922A/R925A/Q926APromoterCMVAvailable SinceSept. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
MMW3629 - human expression plasmid for SpCas9 Cluster 3 + Q926A
Plasmid#101188PurposeHuman expression plasmid for SpCas9 Cluster 3 + Q926A variant: CMV-T7-hSpCas9-Cluster3+Q926A(T657A, G658A, W659A, R661A, Q926A)-NLS(SV40)-3xFLAGDepositorInserthSpCas9-Cluster3+Q926A(T657A/G658A/W659A/R661A/Q926A)
Tags3x FLAG and NLS (SV40)ExpressionMammalianMutationT657A/G658A/W659A/R661A/Q926APromoterCMVAvailable SinceSept. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
MMW3759 - human expression plasmid for SpCas9 Cluster 4 + Q926A
Plasmid#101190PurposeHuman expression plasmid for SpCas9 Cluster 4 + Q926A variant: CMV-T7-hSpCas9-Cluster4+Q926A(F491A, M495A, T496A, N497A, Q926A)-NLS(SV40)-3xFLAGDepositorInserthSpCas9-Cluster4+Q926A(F491A/M495A/T496A/N497A/Q926A)
Tags3x FLAG and NLS (SV40)ExpressionMammalianMutationF491A/M495A/T496A/N497A/Q926APromoterCMVAvailable SinceSept. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
MMW3689 - human expression plasmid for SpCas9 Cluster 1 Q695 + Q926A
Plasmid#101181PurposeHuman expression plasmid for SpCas9 Cluster 1 Q695 + Q926A variant: CMV-T7-hSpCas9-Cluster1Q695+Q926A(N692A, M694A, H698A, Q926A)-NLS(SV40)-3xFLAGDepositorInserthSpCas9-Cluster1Q695+Q926A(N692A/M694A/H698A/Q926A)
Tags3x FLAG and NLS (SV40)ExpressionMammalianMutationN692A/M694A/H698A/Q926APromoterCMVAvailable SinceSept. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
MMW3911 - human expression plasmid for SpCas9 Cluster 1 M694 + Q926A
Plasmid#101182PurposeHuman expression plasmid for SpCas9 Cluster 1 M694 + Q926A variant: CMV-T7-hSpCas9-Cluster 1M694+Q926A(N692A, Q695A, H698A, Q926A)-NLS(SV40)-3xFLAGDepositorInserthSpCas9-Cluster1M694+Q926A(N692A/Q695A/H698A/Q926A)
Tags3x FLAG and NLS (SV40)ExpressionMammalianMutationN692A/Q695A/H698A/Q926APromoterCMVAvailable SinceSept. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
MMW3909 - human expression plasmid for SpCas9 Cluster 1 N692 + Q926A
Plasmid#101183PurposeHuman expression plasmid for SpCas9 Cluster 1 N692 + Q926A variant: CMV-T7-hSpCas9-Cluster1N692+Q926A(M694A, Q695A, H698A, Q926A)-NLS(SV40)-3xFLAGDepositorInserthSpCas9-Cluster1N692+Q926A(M694A/Q695A/H698A/Q926A)
Tags3x FLAG and NLS (SV40)ExpressionMammalianMutationM694A/Q695A/H698A/Q926APromoterCMVAvailable SinceSept. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
MMW3001 - human expression plasmid for SpCas9 Cluster 2 + Q926A
Plasmid#101184PurposeHuman expression plasmid for SpCas9 Cluster 2 + Q926A variant: CMV-T7-hSpCas9-Cluster2+Q926A(G582A, V583A, E584A, D585A, N588A, Q926A)-NLS(SV40)-3xFLAGDepositorInserthSpCas9-Cluster2+Q926A(G582A/V583A/E584A/D585A/N588A/Q926A)
Tags3x FLAG and NLS (SV40)MutationG582A/V583A/E584A/D585A/N588A/Q926APromoterCMVAvailable SinceSept. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
MMW3709 - human expression plasmid for SpCas9 Cluster 1 + Q926A
Plasmid#101179PurposeHuman expression plasmid for SpCas9 Cluster 1 + Q926A variant: CMV-T7-hSpCas9-Cluster1+Q926A(N692A, M694A, Q695A, H698A, Q926A)-NLS(SV40)-3xFLAGDepositorInserthSpCas9-Cluster1+Q926A(N692A/M694A/Q695A/H698A/Q926A)
Tags3x FLAG and NLS (SV40)ExpressionMammalianMutationN692A/M694A/Q695A/H698A/Q926APromoterCMVAvailable SinceSept. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
MMW3914 - human expression plasmid for SpCas9 Cluster 1 H698 + Q926A
Plasmid#101180PurposeHuman expression plasmid for SpCas9 Cluster 1 H698 + Q926A variant: CMV-T7-hSpCas9-Cluster1H698+Q926A(N692A, M694A, Q695A, Q926A)-NLS(SV40)-3xFLAGDepositorInserthSpCas9-Cluster1H698+Q926A(N692A/M694A/Q695A/Q926A)
Tags3x FLAG and NLS (SV40)ExpressionMammalianMutationN692A/M694A/Q695A/Q926APromoterCMVAvailable SinceSept. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-SAP155c
Plasmid#87390PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting SAP155c sequence ATGAAAGACAACTATAGGGC in yeast chromosome 6DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting SAP155c
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS607c
Plasmid#87388PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS607c sequence CTATTTTTGCTTTCTGCACA in yeast chromosome 6.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS607c
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only