We narrowed to 7,099 results for: mcherry
-
Plasmid#247647PurposeExpresses GFP-SUMO-Tyr-mCherry N-degron reporter driven by aTc responsive promoter, from KanR integrating mycobacterial plasmid lacking Ulp1DepositorInsertGFP-SUMO-Tyr-mCherry N-degron proteolysis dual-fluorescence reporter
UseMycobacterial integratingTagsHA tag and Myc tagExpressionBacterialPromoterPTetAvailable SinceDec. 9, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pTKI-Ser
Plasmid#247648PurposeExpresses GFP-SUMO-Ser-mCherry N-degron reporter driven by aTc responsive promoter, from KanR integrating mycobacterial plasmid lacking Ulp1DepositorInsertGFP-SUMO-Ser-mCherry N-degron proteolysis dual-fluorescence reporter
UseMycobacterial integratingTagsHA tag and Myc tagExpressionBacterialPromoterPTetAvailable SinceDec. 9, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pLN053
Plasmid#247313PurposeExpression of PopZ fused to mCherry and sfGFP under the control of the PopZ promoter (KanR)DepositorInsertPopZ (popZ Caulobacter crescentus)
TagsmCherry and sfgfpExpressionBacterialPromoterPPopZAvailable SinceNov. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pJL403
Plasmid#243721PurposeStably expresses a chimeric reporter with a mCherry (1-105aa)-XTEN250 linker-TBRG4(351aa-631aa), flanked by 5' and 3'UTRs of ALDH18A1 and no mitochondrial targeting sequenceDepositorInsertmCherry(1-105aa)-XTEN250-TBRG4(351aa-631aa), flanked by 5' and 3'UTRs of ALDH18A1 and no mitochondrial targeting sequence
UseLentiviralAvailable SinceOct. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pUt-mNF-Cas13d
Plasmid#224789PurposeLPUtopia matching RMCE donor plasmid with mCherry-P2A-RfxCas13d Negative-Feedback circuit. Use BlastR for positive selection and HSV-TK for negative selection.DepositorInsertmCherry-P2A-RfxCas13d
UseCRISPR and Synthetic BiologyExpressionMammalianPromoterCMV-d2iAvailable SinceOct. 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJH4506
Plasmid#200255PurposePnpr-4 TeTx mCherry unc-54 3' UTR C.elegans AVA and other neurons expression of TeTx RFPDepositorInsertTeTx
TagsmCherryExpressionWormPromoterPnpr-4Available SinceMay 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJH4508
Plasmid#200256PurposePflp-18 LoxP EBFP LoxP TeTx mCherry unc-54 3' UTR C.elegans AVA and other neurons expression of TeTx RFPDepositorInsertTeTx
TagsmCherryExpressionWormPromoterPflp-18Available SinceMay 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
p3805
Plasmid#198147PurposeMammalian expression of LAMP1-miniSOGDepositorAvailable SinceMarch 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
p3806
Plasmid#198148PurposeMammalian expression of LAMP1-miniSOGDepositorAvailable SinceMarch 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pUC19-sg-1
Plasmid#190607PurposeExpresses a gRNA for base editing the EGFP Kozak sequence of pWPT-/mEGFP-1T-IRES-mCherryDepositorInsertgRNA sequence
UseCRISPRExpressionMammalianPromoterU6Available SinceOct. 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pACE-GIRK2-mC-S
Plasmid#172428PurposeExpression of full-length, human GIRK4 with C-terminal mCherry StrepTag IIDepositorAvailable SinceOct. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
attB53_SNCB-_attB53
Plasmid#183615PurposeRMCE vector to shuttle puromycin resistance (+), anti-GFP SynNotch receptor (+), tagBFP (-) and TRE-mCherry (-) cassettes into attP50-flanked landing pad (Addgene 183609). (+) = sense (-) = antisense.DepositorInsertsLaG17 GFP nanobody SynNotch tTA
TRE-mCherry-SV40pA
tagBFP
UseRmceTagsMyc and human CD8a signal sequenceExpressionMammalianAvailable SinceSept. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSLQ1371-sgYAP-10
Plasmid#121424PurposesgYAP-10 sequence: GTGCTGTCCCAGATGAACGTC. Lentiviral mouse U6 (mU6) promoter-driven expression vector that coexpessed Puro-T2A-mCherry from a CMV promoter.DepositorInsertsgYAP-10 (GTGCTGTCCCAGATGAACGTC)
UseCRISPR and LentiviralTagsmCherryExpressionMammalianPromotermouse U6Available SinceApril 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
-
-
pSR11
Plasmid#69154Purposeread-outloxP mCherry to GFP switch, with fzr-1 promoter, gene and UTR, for integration on cxtTi10816, Mos Chr IVDepositorInsertsUseCre/Lox; MossciExpressionWormMutationcodon-optimzed index 1.0Promoterfzr-1 and rps-27Available SinceFeb. 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
sgFFL_d23
Plasmid#59892Purposesynthetic autoregulatory gene circuit made by inserting an intron containing the mouse mir-124–3 gene into mCherry. Contains the miR-124-regulated 3′UTR of the Vamp3 gene with two seed sites mutatedDepositorInsertmCherry with intron containing the mouse mir-124–3
TagsPEST and VAMP 3 UTRExpressionMammalianMutationVAMP 3 UTR--3rd and fourth seed site removedPromoterdoxycycline (Dox)-inducible promoter (CMV/TO)Available SinceApril 1, 2015AvailabilityAcademic Institutions and Nonprofits only -
sgFFL_d3
Plasmid#59891Purposesynthetic autoregulatory gene circuit made by inserting an intron containing the mouse mir-124–3 gene into mCherry. Contains the miR-124-regulated 3′UTR of the Vamp3 gene with one seed site mutated.DepositorInsertmCherry with intron containing the mouse mir-124–3
TagsPEST and VAMP 3 UTRExpressionMammalianMutationVAMP 3 UTR--3rd seed site removedPromoterdoxycycline (Dox)-inducible promoter (CMV/TO)Available SinceApril 1, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDOE20 mC VN
Plasmid#124246PurposeAllows fluorescent (mVENUS; mCherry) co-localization of two proteins in Agrobacterium- transformed plant cells.DepositorTypeEmpty backboneExpressionPlantAvailable SinceApril 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pEM124
Plasmid#248735PurposeEntry Vector for inserting Inducible promoters upstream of sfGFP in pNBU2 integrative Bacteroides plasmidDepositorInsert[pJ2300-PETRBS-mCherry-rrnBT1 dropout
ExpressionBacterialAvailable SinceJan. 9, 2026AvailabilityAcademic Institutions and Nonprofits only