We narrowed to 9,569 results for: Plat
-
Plasmid#254079PurposeRetroviral transfer vector for IL17RB-tTA fusion gene expression, QL linker, puromycin selection marker, for CyCLoPs platform.DepositorInsertIL17RB-tTA
UseRetroviralAvailable SinceMarch 30, 2026AvailabilityAcademic Institutions and Nonprofits only -
MIGR1-TGFBR2-TEV-SV40-hygro
Plasmid#254115PurposeRetroviral transfer vector for TGFBR2-TEV fusion gene expression, Hygromycin selection marker, for CyCLoPs platform.DepositorInsertTGFBR2-TEV
UseRetroviralMutationAA194: GGT to GGC synonymous mutationAvailable SinceMarch 30, 2026AvailabilityAcademic Institutions and Nonprofits only -
MIGR1-IL1R1-TEV-SV40-hygro
Plasmid#254103PurposeRetroviral transfer vector for IL1R1-TEV fusion gene expression, Hygromycin selection marker, for CyCLoPs platform.DepositorInsertIL1R1-TEV
UseRetroviralMutationAA370: TAC to TAT synonymous mutationAvailable SinceMarch 30, 2026AvailabilityAcademic Institutions and Nonprofits only -
pPMEL-Nluc-hbb
Plasmid#239862PurposeTemplate for in vitro transcription of secreted nanoluciferase, with signal peptide from PMEL, flanked by the human haemoglobin beta 5' and 3' UTRs.DepositorInsertSecreted nanoluciferase, with signal peptide from PMEL (gp100), flanked by human haemoglobin beta 5' and 3' UTRs
UseLuciferasePromoterT7 (included as part of insert)Available SinceJuly 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
LIG4 HAL-T2A-GFP-SV40pA-HAR
Plasmid#225357PurposeThis plasmid serves as a template for homologous DNA recombination at the LIG4 gene to knock out the DNA ligase 4 protein using the SelectRepair knockout GFP approach.DepositorInsertT2A-GFP-SV40pA
UseCRISPRAvailable SinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
LIG4 HAL-T2A-HYG-SV40pA-HAR
Plasmid#225358PurposeThis plasmid serves as a template for homologous DNA recombination at the LIG4 gene to knock out the DNA ligase 4 protein using the hygromycin B SelectRepair knockout approach.DepositorInsertT2A-HYG-SV40pA
UseCRISPRAvailable SinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
LIG4 HAL-T2A-NEO-SV40pA-HAR
Plasmid#225359PurposeThis plasmid serves as a template for homologous DNA recombination at the LIG4 gene to knock out the DNA ligase 4 protein using the neomycin SelectRepair knockout approach.DepositorInsertT2A-NEO-SV40pA
UseCRISPRAvailable SinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
XZ390 (IVT) CMV-TO-T7-mCherry-SGc(stem-1(3xMS2))cSG-rTetR-NZF-NLS-hybridUTR3
Plasmid#233425PurposeIVT template for LIDAR reporter mRNA; mCherry as marker, rtetR-NZF as outputDepositorInsertT7-mCherry-SGc(stem-1(3xMS2))cSG-rTetR-NZF-NLS-hybridUTR3
ExpressionMammalianMutationWTPromoterCMVAvailable SinceApril 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pT7-IVT_ACC-msfGFP[r5M]_ACC-mEBFP2
Plasmid#221082PurposePlasmid for producing DNA Templates for in vitro transcription. Produces msfGFP[r5M] and mEBFP2 from IVT mRNA.DepositorInsertACC-msfGFP[r5M]_ACC-mEBFP2
UseSynthetic BiologyPromoterCMV, T7Available SinceSept. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHDR_NPM2-T2A-mGreenLantern-PuroTK
Plasmid#222910PurposeHomology directed repair template for knocking in mGreenLantern reporter to NPM2.DepositorInsertmGreenLantern
UseCRISPRAvailable SinceJuly 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHDR_FIGLA-T2A-mGreenLantern-PuroTK
Plasmid#222905PurposeHomology directed repair template for knocking in mGreenLantern reporter to FIGLA.DepositorInsertmGreenLantern
UseCRISPRAvailable SinceJuly 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHDR2_TFAP2C-T2A-mGreenLantern-Hygro
Plasmid#222915PurposeHomology directed repair template for knocking in mGreenLantern reporter to TFAP2C.DepositorInsertmGreenLantern
UseCRISPRAvailable SinceJuly 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
PTAFR-DuET
Plasmid#213368PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorAvailable SinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDY279
Plasmid#182959PurposeStr resistant,CoE1* ori. CRISPR/Cas9 gRNA under constitutive J23119 promoter. gRNA targeting E. coli ptsI codon 2~9. HRT has synonymous mutations in ptsI. (for 1st round editing)DepositorInsertgRNA (ttcaggcattttagcatccc), homologous repair template for ptsI
UseSynthetic BiologyExpressionBacterialAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDY281
Plasmid#182960PurposeAmp resistant, CoE1* ori. CRISPR/Cas9 induced by AHTc, gRNA under constitutive J23119 promoter. gRNA targeting E. coli ptsI codon 2~9. HRT has synonymous mutations of ptsI. (for 2nd round editing)DepositorInsertgRNA (acctggtgaagccaatattc), homologous repair template for ptsI
UseSynthetic BiologyExpressionBacterialAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC57-RPLP15UTR-hRluc-A60
Plasmid#182639PurposeTranscription template plasmid for RPLP1 5'UTR followed by Renilla luciferase open reading frame and polyA sequenceDepositorInsertRenilla luciferase
UseLuciferaseExpressionMammalianMutationThe transcription is driven by a T7 promoter, pai…Available SinceJuly 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pXD71Cas10.6RT4-Pct5.1-crRNA(hcdR)-RT(ΔhcdR)
Plasmid#191646PurposeE. coli - Eggerthella lenta shuttle plasmid (KanR), cumate-inducible promoter Pct5.1-crRNA(hcdR-targeting spacer) hcdR-deleting repair template, used for hcdR deletionDepositorInsertCymR
UseCRISPRExpressionBacterialAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pExpreS2-1-CR-PA
Plasmid#175445PurposeHiFi-compatible destination vector for secreted overexpression of thrombin-cleavable, C-terminal Protein A tagged proteins with ExpreS2 PlatformDepositorTypeEmpty backboneTagsBiP Secretion Peptide and Thrombin-Protein AExpressionInsectPromoterFused Actin-HSP70Available SinceMarch 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBS-f1(-)-TOMM20-dTomato
Plasmid#115922Purposedonor to insert dTomato at the TOMM20 locus in human cellsDepositorInsertTOMM20-dTomato
UseDonor templateTagsdTomatoAvailable SinceMarch 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBS-f1(+)-GAPDH-IRES-dTomato
Plasmid#115912Purposedonor to insert IRES-dTomato at the GAPDH locus in human cellsDepositorInsertIRES-dTomato
UseDonor templateTagsdTomatoAvailable SinceMarch 19, 2021AvailabilityAcademic Institutions and Nonprofits only