We narrowed to 6,201 results for: org
-
Plasmid#226108PurposeUsing ef-1a promoter, expresses dCas9 and RecT protein that intended to be tethered via MS2 gRNA hairpin to dCas9, and Blasticidin selectionDepositorInsertBSD
UseCRISPRExpressionMammalianAvailable SinceNov. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
hPSD-95_PDZ3
Plasmid#245905PurposeBacterial expression of PSD-95 PDZ3 domain (302-402)DepositorAvailable SinceOct. 23, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
hPSD-95_PDZ2
Plasmid#245904PurposeBacterial expression of PSD-95 PDZ2 domain (155-249)DepositorAvailable SinceOct. 23, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pUBC(k)-AT5G42080-mKOk
Plasmid#224852PurposePlasmid for expression of AT5G40280.1 coding sequence tagged with mKOk in plantsDepositorInsertAT5G40280.1 (ERA1 Mustard Weed)
ExpressionPlantAvailable SinceJuly 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pUBC(k)-AT4G33650-mKOk
Plasmid#224846PurposePlasmid for expression of AT4G33650.1 coding sequence tagged with mKOk in plantsDepositorInsertAT4G33650.1 (DRP3A Mustard Weed)
ExpressionPlantAvailable SinceJuly 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDEST-Dok1-V2
Plasmid#215452PurposeExpression vector with Dok1 tagged with the BiFC V2 fragmentDepositorAvailable SinceMay 29, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pHW1387
Plasmid#229880PurposeNegative selection marker for extrachromosomal arrays during RMCE crosses - Pmyo-2::HisCl1 cDNA::SL2::GFP-C1::tbb-2 3'UTRDepositorInsertPmyo-2::HisCl1 cDNA::SL2::GFP-C1::tbb-2 3'UTR
TagsGFP-C1ExpressionWormAvailable SinceFeb. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHW1392
Plasmid#229878PurposeNegative selection marker for extrachromosomal arrays during RMCE crosses- Psnt-1::HisCl1 cDNA::SL2::GFP-C1::tbb-2 3'UTRDepositorInsertPsnt-1::HisCl1 cDNA::SL2::GFP-C1::tbb-2 3'UTR
TagsGFP-C1ExpressionWormAvailable SinceFeb. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHW1391
Plasmid#229877PurposeNegative selection marker for extrachromosomal arrays during RMCE crosses - Psnt-1::HisCl1 cDNA::SL2::mScarlet-I-C1::tbb-2 3'UTRDepositorInsertPsnt-1::HisCl1 cDNA::SL2::mScarlet-I-C1::tbb-2 3'UTR
TagsmScarlet-I-C1ExpressionWormAvailable SinceFeb. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pPB-cT3G-cERP2-ZGLP1
Plasmid#222926PurposePiggyBac transposon plasmid for doxycycline inducible expression of ZGLP1DepositorInsertZGLP1 (ZGLP1 Human)
ExpressionMammalianAvailable SinceJuly 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Hbb
Plasmid#99693PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Hbb promoter, vector allows for activation of mouse Hbb, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Hbb (gRNA: GGGGTAAGGGGAGCAAGGTC) (Hbb Synthetic, Mouse)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceMay 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBI101.1/ProGOXL6:GUS
Plasmid#175562PurposeBinary vector for Agrobacterium-mediated plant transformation - Promoter:GUS reporter for expression analysis of GOXL genesDepositorInsertProGOXL6
TagsGUSExpressionPlantPromoterGOXL6Available SinceJan. 13, 2022AvailabilityIndustry, Academic Institutions, and Nonprofits -
pBI101.1/ProGOXL5:GUS
Plasmid#175561PurposeBinary vector for Agrobacterium-mediated plant transformation - Promoter:GUS reporter for expression analysis of GOXL genesDepositorInsertProGOXL5
TagsGUSExpressionPlantPromoterGOXL5Available SinceJan. 13, 2022AvailabilityIndustry, Academic Institutions, and Nonprofits -
pBI101.1/ProGOXL4:GUS
Plasmid#175560PurposeBinary vector for Agrobacterium-mediated plant transformation - Promoter:GUS reporter for expression analysis of GOXL genesDepositorInsertProGOXL4
TagsGUSExpressionPlantPromoterGOXL4Available SinceJan. 13, 2022AvailabilityIndustry, Academic Institutions, and Nonprofits -
pBI101.1/ProGOXL3:GUS
Plasmid#175559PurposeBinary vector for Agrobacterium-mediated plant transformation - Promoter:GUS reporter for expression analysis of GOXL genesDepositorInsertProGOXL3
TagsGUSExpressionPlantPromoterGOXL3Available SinceJan. 13, 2022AvailabilityIndustry, Academic Institutions, and Nonprofits -
pBI101.1/ProGOXL2:GUS
Plasmid#175558PurposeBinary vector for Agrobacterium-mediated plant transformation - Promoter:GUS reporter for expression analysis of GOXL genesDepositorInsertProGOXL2
TagsGUSExpressionPlantPromoterGOXL2Available SinceJan. 13, 2022AvailabilityIndustry, Academic Institutions, and Nonprofits -
LentiCRISPRv2-neo-dTgfa
Plasmid#173842PurposeA knockout vector for the dog Tgfa.DepositorInsertA gRNA targeting the dog Tgfa gene and the cDNA of CRISPR-Cas9
UseCRISPR and LentiviralAvailable SinceOct. 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2puro-Ptgfr
Plasmid#170303PurposeA knock-out vector for the mouse PtgfrDepositorInsertA gRNA targeting the mouse Ptgfr gene.
UseCRISPR and LentiviralAvailable SinceJuly 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pgRNA_CV2
Plasmid#167165PurposepgRNA_CV2 is derived from gRNA_cloning vector (Addgene plasmid ID: 41824) by adding about 80 bps from the sgRNA sequence as well as an AgeI site. In the literature, sgRNA_AL is used as an alias.DepositorTypeEmpty backboneUseCRISPRExpressionMammalianPromoterU6 promoterAvailable SinceMay 28, 2021AvailabilityAcademic Institutions and Nonprofits only -