We narrowed to 5,873 results for: org
-
Plasmid#60324PurposeHNF4A P2 promoter cloned into the pGL2-basic backbone.DepositorAvailable SinceJan. 6, 2015AvailabilityAcademic Institutions and Nonprofits only
-
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Neurog2
Plasmid#99694PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA: GGTATATAAGGGGTTTTAAG) (Actc1 Synthetic, Mouse)
UseAAV and CRISPRTagsVPR miniMutationdead Cas9Available SinceJan. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSBbi-RP-CoV2/RBD-puro
Plasmid#161793PurposeTransposon-based SARS-CoV-2 RBD stable expression vector for protein productionDepositorInsertSARS-CoV-2 RBD
UseTransposonTags6xHis and dTomatoExpressionMammalianPromoterEF1a/RPBSAAvailable SinceJuly 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
retro-gfp-puro vector
Plasmid#58249PurposeRetroviral expression vector encoding bicistronic EGFP and Puromycin cassetteDepositorInsertEGFP
UseRetroviralExpressionMammalianAvailable SinceMarch 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSBbi-RP-CoV2/stSpike-puro
Plasmid#161794PurposeTransposon-based SARS-CoV-2 secretable trimeric Spike stable expression vector for protein productionDepositorInsertSARS-CoV-2 secretable trimeric Spike
UseTransposonTags6xHis and dTomatoExpressionMammalianPromoterEF1a/RPBSAAvailable SinceAug. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEGFP C1-Eps8 ∆cap/∆bund
Plasmid#74891Purposemammalian expression of the capping and bundling activity mutant Eps8 fused to GFPDepositorAvailable SinceMay 3, 2016AvailabilityAcademic Institutions and Nonprofits only -
pChuk
Plasmid#87033Purposeexpress IKKalpha in mammalian cellsDepositorAvailable SinceJuly 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pX459-dCTNNA1
Plasmid#176032PurposeA knock-out vector for dog CTNNA1 (alpha-1-catenin)DepositorInsertA gRNA targeting the dog CTNNA1 (alpha-1-catenin) gene and the cDNA of Cas9 (CTNNA1 )
UseCRISPRExpressionMammalianAvailable SinceOct. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-HES5
Plasmid#101409PurposeDonor Vector containing HES5 transcription factor, part of the Human TFome CollectionDepositorInsertHES5 (HES5 Human)
UseGateway shuttling vectorMutationLast nucleotide of stop codon removed to allow fo…Available SinceJune 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-Flag-PGC-1alpha2
Plasmid#45502DepositorAvailable SinceAug. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
pKlab1157-HBEGF-2a-3xFLAG-BRCA1(full-length)-P1749S-2a-mRuby3-HBBIVS2-WPRE
Plasmid#248997PurposeThis plasmid expresses the BRCA1 sequence with P1749S mutation, the construct includes a HBBIVS2 intron sequence at the 3' end of the mRuby sequence to improve the stable integration into cell linesDepositorAvailable SinceJan. 21, 2026AvailabilityAcademic Institutions and Nonprofits only -
pKlab1158-HBEGF-2a-3xFLAG-BRCA1(full-length)-R1699Q-2a-mRuby3-HBBIVS2-WPRE
Plasmid#248998PurposeThis plasmid expresses the BRCA1 sequence with R1699Q mutation, the construct includes a HBBIVS2 intron sequence at the 3' end of the mRuby sequence to improve the stable integration into cell linesDepositorAvailable SinceJan. 21, 2026AvailabilityAcademic Institutions and Nonprofits only -
pKlab1159-HBEGF-2a-3xFLAG-BRCA1(full-length)-R1699W-2a-mRuby3-HBBIVS2-WPRE
Plasmid#248999PurposeThis plasmid expresses the BRCA1 sequence with R1699W mutation, the construct includes a HBBIVS2 intron sequence at the 3' end of the mRuby sequence to improve the stable integration into cell linesDepositorAvailable SinceJan. 21, 2026AvailabilityAcademic Institutions and Nonprofits only -
pKlab1160-HBEGF-2a-3xFLAG-BRCA1(full-length)-S1655F-2a-mRuby3-HBBIVS2-WPRE
Plasmid#249000PurposeThis plasmid expresses the BRCA1 sequence with S1655F mutation, the construct includes a HBBIVS2 intron sequence at the 3' end of the mRuby sequence to improve the stable integration into cell linesDepositorAvailable SinceJan. 21, 2026AvailabilityAcademic Institutions and Nonprofits only -
pKlab1161-HBEGF-2a-3xFLAG-BRCA1(full-length)-V1736A-2a-mRuby3-HBBIVS2-WPRE
Plasmid#249001PurposeThis plasmid expresses the BRCA1 sequence with V1736A mutation, the construct includes a HBBIVS2 intron sequence at the 3' end of the mRuby sequence to improve the stable integration into cell linesDepositorAvailable SinceJan. 21, 2026AvailabilityAcademic Institutions and Nonprofits only -
pKlab1069-HBEGF-2a-3xFLAG-BRCA1(full-length)-A1708V-2a-mRuby3-HBBIVS2-WPRE
Plasmid#248989PurposeThis plasmid expresses the BRCA1 sequence with A1708V mutation, the construct includes a HBBIVS2 intron sequence at the 3' end of the mRuby sequence to improve the stable integration into cell linesDepositorAvailable SinceJan. 21, 2026AvailabilityAcademic Institutions and Nonprofits only -
pKlab1066-HBEGF-2a-3xFLAG-BRCA1(full-length)-L1705R-2a-mRuby3-HBBIVS2-WPRE
Plasmid#248990PurposeThis plasmid expresses the BRCA1 sequence with L1705R mutation, the construct includes a HBBIVS2 intron sequence at the 3' end of the mRuby sequence to improve the stable integration into cell linesDepositorAvailable SinceJan. 21, 2026AvailabilityAcademic Institutions and Nonprofits only -
pKlab1070-HBEGF-2a-3xFLAG-BRCA1(full-length)-Y1845D-2a-mRuby3-HBBIVS2-WPRE
Plasmid#248991PurposeThis plasmid expresses the BRCA1 sequence with Y1845D mutation, the construct includes a HBBIVS2 intron sequence at the 3' end of the mRuby sequence to improve the stable integration into cell linesDepositorAvailable SinceJan. 21, 2026AvailabilityAcademic Institutions and Nonprofits only -
pKlab1067-HBEGF-2a-3xFLAG-BRCA1(full-length)-S1715R-2a-mRuby3-HBBIVS2-WPRE
Plasmid#248992PurposeThis plasmid expresses the BRCA1 sequence with S1715R mutation, the construct includes a HBBIVS2 intron sequence at the 3' end of the mRuby sequence to improve the stable integration into cell linesDepositorAvailable SinceJan. 21, 2026AvailabilityAcademic Institutions and Nonprofits only -
pKlab1153-HBEGF-2a-3xFLAG-BRCA1(full-length)-D1692N-2a-mRuby3-HBBIVS2-WPRE
Plasmid#248993PurposeThis plasmid expresses the BRCA1 sequence with D1692N mutation, the construct includes a HBBIVS2 intron sequence at the 3' end of the mRuby sequence to improve the stable integration into cell linesDepositorAvailable SinceJan. 21, 2026AvailabilityAcademic Institutions and Nonprofits only