We narrowed to 80,546 results for: MYC
-
Plasmid#162843PurposeExpression protein designed PodA10 from a TEV cleavable IPTG inducible plasmid with ampicillin resistanceDepositorInsertProtein Designed Pyocyanin demethylase
TagsTEV-cleavable 6x-His tagExpressionBacterialMutationA53N, I73T, A87V, M99V, A129T from WT PodAPromoterT7Available SinceSept. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pKP110 [pRS416-YBR139Wp-YBR139W(N163,242Q)-PA-ADH1t]
Plasmid#106462PurposeExpresses Atg42/Ybr139w(N163,242Q) with a C-terminal PA tag in yeast cellsDepositorInsertYBR139W(N163,242Q)
TagsPAExpressionBacterial and YeastMutationchanged Asparagines at positions 163 and 242 to G…PromoterYBR139WAvailable SinceJune 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pKP129 [pRS406-YBR139Wp-YBR139W(S219A)-GFP-ADH1t]
Plasmid#106466PurposeExpresses Atg42/Ybr139w(S219A) with a C-terminal GFP tag in yeast cellsDepositorInsertYBR139W(S219A)
TagsGFPExpressionBacterial and YeastMutationChanged Serine 219 to AlaninePromoterYBR139WAvailable SinceJune 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pKP131 [pRS406-YBR139Wp-YBR139W(H474A)-GFP-ADH1t]
Plasmid#106467PurposeExpresses Atg42/Ybr139w(H474A) with a C-terminal GFP tag in yeast cellsDepositorInsertYBR139W(H474A)
TagsGFPExpressionBacterial and YeastMutationChanged Histidine 474 to AlaninePromoterYBR139WAvailable SinceJune 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pKP133 [pRS406-YBR139Wp-YBR139W(D415A)-GFP-ADH1t]
Plasmid#106468PurposeExpresses Atg42/Ybr139w(D415A) with a C-terminal GFP tag in yeast cellsDepositorInsertYBR139W(D415A)
TagsGFPExpressionBacterial and YeastMutationChanged Aspartate 415 to AlaninePromoterYBR139WAvailable SinceJune 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS208a
Plasmid#87383PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS208a sequence GTCCGCTAAACAAAAGATCT in yeast chromosome 2.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS208a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLSB-HYG
Plasmid#166699PurposeCombined sgRNA/Cas9 pLSB vector with hphMX6 (hygromycin) marker. Golden Gate-ready for cloning custom sgRNA sequences.DepositorInsertstRNA promoter : sgRNA cassette
adh15 promoter : Cas9 codon-optimised for S. pombe
ExpressionYeastPromoteradh15 promoter and tRNA promoterAvailable SinceApril 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCMV-hATG7wt
Plasmid#87867PurposeExpress a wild type human Atg7/Apg7 in mammalian cellsDepositorAvailable SinceAug. 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-CAN1y
Plasmid#87391PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting CAN1y sequence GATACGTTCTCTATGGAGGA in yeast chromosome 6.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting CAN1y
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p425_Cas9_gRNA_LEU_1014a
Plasmid#87407Purposep425_Cas9_gRNA-ARS1014a All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, LEU2 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1014a sequence TTATGTGCGTATTGCTTTCA in yeast chromosome 10.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1014a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-YPRCd15c
Plasmid#87404PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting YPRCd15c sequence AATCCGAACAACAGAGCATA in yeast chromosome 14.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting YPRCd15c
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-hLC3
Plasmid#87872PurposeExpress a EGFP-human MAP1-LC3 in mammalian cellsDepositorInsertMAP1LC3 (MAP1LC3B Human)
ExpressionMammalianAvailable SinceAug. 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pGLOW39
Plasmid#173068PurposemScarlet^SEC^3xMyc vector with ccdB sites for cloning homology armsDepositorInsertmScarlet-I-C1^SEC^3xMyc
UseCRISPR and Cre/LoxTags3xMyc and C. elegans codon-optimized mScarletExpressionWormAvailable SinceOct. 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCDF-Az
Plasmid#197101PurposeTo express the azidophenylalanine-specific variant of Methanocaldococcus jannaschii TyrRS and its cognate amber suppressor tRNA and allow UAG codon to be translated into azidophenylalanineDepositorInsertTyrRS variant, amber suppressor tRNA, kanamycin resistance gene
ExpressionBacterialMutationThr32, Asn107, Pro158, Leu159, Gln162, Arg286 (Ty…Available SinceJune 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pENTR-DMD-Donor
Plasmid#60605PurposeKnock-in donor vector to insert Exon 44 in front of Exon 45 of human DYSTROPHIN (DMD)gene, include EF1a-hygromycin resistance cassette flanked by loxP sequences.DepositorInsertHygromycin resistant gene
UseKnock-in donor vectorExpressionMammalianAvailable SinceDec. 15, 2014AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS416d
Plasmid#87386PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS416d sequence TAGTGCACTTACCCCACGTT in yeast chromosome 4.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS416d
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMEL16
Plasmid#107922PurposeHIS3 based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y
UseCRISPRExpressionYeastAvailable SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTBL680 CHYRON3 integration construct
Plasmid#126448PurposeTo integrate the CHYRON3 locus at AAVS1 in human cells.DepositorInsertspU6/3xLacO-CHYRON3 hgRNA
pCMV-puro
ExpressionMammalianMutationThe SpCas9 sgRNA constant region is mutated to ma…PromoterCMV and human U6/3xLacOAvailable SinceJune 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMEL10
Plasmid#107916PurposeURA3 based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y
UseCRISPRExpressionYeastAvailable SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pNK3203
Plasmid#219749PurposeDVK_AF CIDAR vector encoding hispidin-synthase from Mycena citricolor under control of CMV promoter, for mammalian expressionDepositorInsertpCMV - mcitHispS - tSV40
ExpressionMammalianAvailable SinceJuly 12, 2024AvailabilityAcademic Institutions and Nonprofits only