We narrowed to 7,952 results for: Lif
-
Plasmid#222650PurposeFor in vitro transcription of mouse Zc3h12a D141N mutant tagged with FLAG-HA at N-termDepositorInsertZc3h12a (Zc3h12a Mouse)
UseIn vitro transcriptionTagsFLAG and HAMutationmutated aspartic acid 141 to asparagine to abroga…PromoterT7Available SinceOct. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-IRES-mOrange/CALR ins5
Plasmid#214769PurposeMammalian expression of human CALR ins5DepositorAvailable SinceApril 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1/CALR ins5 (del18-197)-FLAG
Plasmid#204539PurposeMammalian expression of human CALR ins5 (del18-197)-FLAGDepositorAvailable SinceSept. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1/CALR ins5 (del198-430)-FLAG
Plasmid#204538PurposeMammalian expression of human CALR ins5 (del198-430)-FLAGDepositorAvailable SinceSept. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1/CALR ins5 (del367-430)-FLAG
Plasmid#204536PurposeMammalian expression of human CALR ins5 (del367-430)-FLAGDepositorAvailable SinceSept. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1/CALR ins5 (del309-430)-FLAG
Plasmid#204537PurposeMammalian expression of human CALR ins5 (del309-430)-FLAGDepositorAvailable SinceSept. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1/CALR ins5 (del1-308)-FLAG
Plasmid#204535PurposeMammalian expression of human CALR ins5 (del1-308)-FLAGDepositorAvailable SinceSept. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1/CALR ins5 (del198-308)-FLAG
Plasmid#204540PurposeMammalian expression of human CALR ins5 (del198-308)-FLAGDepositorAvailable SinceSept. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1/CALR ins5 (del1-197)-FLAG
Plasmid#204534PurposeMammalian expression of human CALR ins5 (del1-197)-FLAGDepositorAvailable SinceSept. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
Lenti_EGFP-P2A_truncHaus6_IRES_Blast
Plasmid#182885PurposeTransfer vector for production of lentivirus. Control plasmid for rescue experiment of HAUS6 depletion phenotype, containing a nonsense mutation and a truncation in HAUS6.DepositorInsertHAUS 6 (HAUS6 Human)
UseLentiviralExpressionBacterial and MammalianMutationstop codon introduced 2 amino acids downstream of…PromoterEF1alpha coreAvailable SinceJuly 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pB6-Lrig1-T2A-sfGFP-iCre-ERT2-FNF-TK
Plasmid#126651PurposeB6J Lrig1-T2A-sfGFP-iCre-ERT2 allele targeting vector, low copy numberDepositorInsertLrig1 (Lrig1 Mouse)
UseCre/Lox and Mouse TargetingMutationC-terminal fusion of T2A-sfGFP-iCre-ERT2Available SinceMarch 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pYLCRISPR/Cas9P35S-H
Plasmid#66189Purposeexpression of Cas9 in plants, cauliflower mosaic virus 35S promoter (P35S), hygro selectionDepositorInsertCas9
ExpressionPlantMutationplant-codon optimized with higher GC contents (62…Promotercauliflower mosaic virus 35S promoter (P35S)Available SinceJune 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAGT9054
Plasmid#219430PurposeTranscriptional unit (MoClo-position 2): 2x35Ss_Omega enhancer_PapE-4LF2-N-SpCas9i-N_tOCSDepositorInsertLB_2x35Ss-omega enhancer:PapE-4xLF2-NLS-SpCas9i-NLS:tOCS_RB (Position 2)
UseCRISPR; Moclo compatible level 1 module (position…TagsPapE-4LF2ExpressionPlantAvailable SinceJuly 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
3` CC: Hygro – H2B-GFP-N – loxP – mScarlet
Plasmid#219565Purpose3` circularization cassette to induce Cre-mediated circularization of a genomic region flanked by loxP sites with H2B-GFP reconstitution and mScarlet expression from the chromosomeDepositorInsertHygroR_2A_H2B-GFP-N_loxP_mScarlet
UseUnspecifiedPromoterEF-1aAvailable SinceNov. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
3` CC: Hygro – GFP-N – loxP – mScarlet
Plasmid#219564Purpose3` circularization cassette.To induce Cre-mediated circularization or inversion of a genomic region with concomitant GFP reconstitution and mScarlet expression from the chromosomeDepositorInsert3` CC: Hygro – GFP-N – loxP – mScarlet
UseUnspecifiedPromoterEF1-aAvailable SinceNov. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA 3.1 KBTBD4 WT
Plasmid#184627PurposeMammalian expression vector with N-terminal 3xFlag for KBTBD4 WT expression in mammalian cellsDepositorInsertN-terminal 3xFlag tagged KBTBD4 WT (KBTBD4 Human)
ExpressionMammalianMutationno mutationPromoterCMVAvailable SinceJune 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pYLCRISPR/Cas9P35S-B
Plasmid#66190Purposeexpression of Cas9 in plants, cauliflower mosaic virus 35S promoter (P35S), basta selectionDepositorInsertCas9
ExpressionPlantMutationplant-codon optimized with higher GC contents (62…Promotercauliflower mosaic virus 35S promoter (P35S)Available SinceOct. 23, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCDNA5/FRT/HaloTag7-Geminin(1/110)_P2A_HaloTag9-Cdt(1-110)Cy-
Plasmid#169338PurposeExpression of the LT-Fucci(CA) in mammalian cellsDepositorTagsHaloTag7-Geminin(1/110) and HaloTag9-Cdt(1-110)Cy…ExpressionMammalianMutationHaloTag9 = HaloTag7-Q165H-P174RAvailable SinceNov. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLenti PGK FKBP12(F36V)-OGT (Neo)
Plasmid#154294PurposeLentiviral vector encoding FKBP12(F36V)-2xHA-OGT (Neomycin resistant) off PGK promoterDepositorInsertO-GlcNAc Transferase (OGT Human)
UseLentiviralTags2x HA and FKBP12(F36V)ExpressionMammalianPromoterPGKAvailable SinceNov. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
MB 45t3 thsS(t3)R-sfGFP_mCherry
Plasmid#232470PurposeOptimized thiosulfate sensor with fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
ExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only